diff --git a/jq/gigasecond/.exercism/config.json b/jq/gigasecond/.exercism/config.json
new file mode 100644
index 0000000..ae29eef
--- /dev/null
+++ b/jq/gigasecond/.exercism/config.json
@@ -0,0 +1,19 @@
+{
+  "authors": [
+    "glennj"
+  ],
+  "files": {
+    "solution": [
+      "gigasecond.jq"
+    ],
+    "test": [
+      "test-gigasecond.bats"
+    ],
+    "example": [
+      ".meta/example.jq"
+    ]
+  },
+  "blurb": "Given a moment, determine the moment that would be after a gigasecond has passed.",
+  "source": "Chapter 9 in Chris Pine's online Learn to Program tutorial.",
+  "source_url": "https://pine.fm/LearnToProgram/?Chapter=09"
+}
diff --git a/jq/gigasecond/.exercism/metadata.json b/jq/gigasecond/.exercism/metadata.json
new file mode 100644
index 0000000..bba88b0
--- /dev/null
+++ b/jq/gigasecond/.exercism/metadata.json
@@ -0,0 +1 @@
+{"track":"jq","exercise":"gigasecond","id":"32436c09d4d54b00a98f11eba8015388","url":"https://exercism.org/tracks/jq/exercises/gigasecond","handle":"cafkafk","is_requester":true,"auto_approve":false}
\ No newline at end of file
diff --git a/jq/gigasecond/HELP.md b/jq/gigasecond/HELP.md
new file mode 100644
index 0000000..134fbc0
--- /dev/null
+++ b/jq/gigasecond/HELP.md
@@ -0,0 +1,114 @@
+# Help
+
+## Running the tests
+
+Each exercise contains a test file.
+Run the tests using the `bats` program.
+
+```bash
+bats test-hello-world.bats
+```
+
+`bats` will need to be installed.
+See the [Testing on the Bash track][bash] page for instructions to install `bats` for your system.
+
+### bats is implemented in bash
+
+The bats file is a bash script, with some special functions recognized by the `bats` command.
+You'll see some tests that look like
+
+```sh
+jq -f some-exercise.jq <<< "{some,json,here}"
+```
+
+That `<<<` syntax is a bash [Here String][here-string].
+It sends the string on the right-hand side into the standard input of the program on the left-hand side.
+It is ([approximately][so]) the same as
+
+```sh
+echo "{some,json,here}" | jq -f some-exercise.jq
+```
+
+## Help for assert functions
+
+The tests use functions from the [bats-assert][bats-assert] library.
+Help for the various `assert*` functions can be found there.
+
+## Skipped tests
+
+Solving an exercise means making all its tests pass.
+By default, only one test (the first one) is executed when you run the tests.
+This is intentional, as it allows you to focus on just making that one test pass.
+Once it passes, you can enable the next test by commenting out or removing the
+
+    [[ $BATS_RUN_SKIPPED == true ]] || skip
+
+annotations prepending other tests.
+
+## Overriding skips
+
+To run all tests, including the ones with `skip` annotations, you can run:
+
+```bash
+BATS_RUN_SKIPPED=true bats test-some-exercise.bats
+```
+
+It can be convenient to use a wrapper function to save on typing: in `bash` you can do:
+
+```bash
+bats() {
+    BATS_RUN_SKIPPED=true command bats *.bats
+}
+```
+
+Then run tests with just:
+
+```bash
+bats
+```
+
+## Debugging in `jq`
+
+`jq` comes with a handy [`debug`][debug] filter.
+Use it while you are developing your exercise solutions to inspect the data that is currently in the jq pipline.
+See the [debugging doc][debugging] for more details.
+
+
+[bash]: https://exercism.org/docs/tracks/bash/tests
+[bats-assert]: https://github.com/bats-core/bats-assert
+[here-string]: https://www.gnu.org/software/bash/manual/bash.html#Here-Strings
+[so]: https://unix.stackexchange.com/a/80372/4667
+[debug]: https://jqlang.github.io/jq/manual/v1.7/#debug
+[debugging]: https://exercism.org/docs/tracks/jq/debugging
+
+## Submitting your solution
+
+You can submit your solution using the `exercism submit gigasecond.jq` command.
+This command will upload your solution to the Exercism website and print the solution page's URL.
+
+It's possible to submit an incomplete solution which allows you to:
+
+- See how others have completed the exercise
+- Request help from a mentor
+
+## Need to get help?
+
+If you'd like help solving the exercise, check the following pages:
+
+- The [jq track's documentation](https://exercism.org/docs/tracks/jq)
+- The [jq track's programming category on the forum](https://forum.exercism.org/c/programming/jq)
+- [Exercism's programming category on the forum](https://forum.exercism.org/c/programming/5)
+- The [Frequently Asked Questions](https://exercism.org/docs/using/faqs)
+
+Should those resources not suffice, you could submit your (incomplete) solution to request mentoring.
+
+## Need more help?
+
+- Go to the [Exercism Community forum](https://forum.exercism.org) to get support and ask questions (or just chat!)
+  - Use the [Exercism Support](https://forum.exercism.org/c/support/8) category if you face any issues with working in the web editor, or downloading or submitting your exercises locally.
+  - Use the [Programming:jq](https://forum.exercism.org/c/programming/jq/133) category for jq-specific topics.
+- Join the community on [Exercism's Discord server](https://exercism.org/r/discord).
+- [StackOverflow](https://stackoverflow.com/questions/tagged/jq) can be used to search for your problem and see if it has been answered already.
+  You can also ask and answer questions.
+- [Github issue tracker](https://github.com/exercism/jq/issues) is where we track our development and maintainance of `jq` exercises in exercism.
+  If none of the above links help you, feel free to post an issue here.
\ No newline at end of file
diff --git a/jq/gigasecond/README.md b/jq/gigasecond/README.md
new file mode 100644
index 0000000..97648d5
--- /dev/null
+++ b/jq/gigasecond/README.md
@@ -0,0 +1,52 @@
+# Gigasecond
+
+Welcome to Gigasecond on Exercism's jq Track.
+If you need help running the tests or submitting your code, check out `HELP.md`.
+
+## Introduction
+
+The way we measure time is kind of messy.
+We have 60 seconds in a minute, and 60 minutes in an hour.
+This comes from ancient Babylon, where they used 60 as the basis for their number system.
+We have 24 hours in a day, 7 days in a week, and how many days in a month?
+Well, for days in a month it depends not only on which month it is, but also on what type of calendar is used in the country you live in.
+
+What if, instead, we only use seconds to express time intervals?
+Then we can use metric system prefixes for writing large numbers of seconds in more easily comprehensible quantities.
+
+- A food recipe might explain that you need to let the brownies cook in the oven for two kiloseconds (that's two thousand seconds).
+- Perhaps you and your family would travel to somewhere exotic for two megaseconds (that's two million seconds).
+- And if you and your spouse were married for _a thousand million_ seconds, you would celebrate your one gigasecond anniversary.
+
+~~~~exercism/note
+If we ever colonize Mars or some other planet, measuring time is going to get even messier.
+If someone says "year" do they mean a year on Earth or a year on Mars?
+
+The idea for this exercise came from the science fiction novel ["A Deepness in the Sky"][vinge-novel] by author Vernor Vinge.
+In it the author uses the metric system as the basis for time measurements.
+
+[vinge-novel]: https://www.tor.com/2017/08/03/science-fiction-with-something-for-everyone-a-deepness-in-the-sky-by-vernor-vinge/
+~~~~
+
+## Instructions
+
+Your task is to determine the date and time one gigasecond after a certain date.
+
+A gigasecond is one thousand million seconds.
+That is a one with nine zeros after it.
+
+If you were born on _January 24th, 2015 at 22:00 (10:00:00pm)_, then you would be a gigasecond old on _October 2nd, 2046 at 23:46:40 (11:46:40pm)_.
+
+To solve this exercise in jq, you will need to use the [builtin datetime functions][date-funcs].
+
+[date-funcs]: https://jqlang.github.io/jq/manual/v1.7/#dates
+
+## Source
+
+### Created by
+
+- @glennj
+
+### Based on
+
+Chapter 9 in Chris Pine's online Learn to Program tutorial. - https://pine.fm/LearnToProgram/?Chapter=09
\ No newline at end of file
diff --git a/jq/gigasecond/bats-extra.bash b/jq/gigasecond/bats-extra.bash
new file mode 100644
index 0000000..54d4807
--- /dev/null
+++ b/jq/gigasecond/bats-extra.bash
@@ -0,0 +1,637 @@
+# This is the source code for bats-support and bats-assert, concatenated
+# * https://github.com/bats-core/bats-support
+# * https://github.com/bats-core/bats-assert
+#
+# Comments have been removed to save space. See the git repos for full source code.
+
+############################################################
+#
+# bats-support - Supporting library for Bats test helpers
+#
+# Written in 2016 by Zoltan Tombol <zoltan dot tombol at gmail dot com>
+#
+# To the extent possible under law, the author(s) have dedicated all
+# copyright and related and neighboring rights to this software to the
+# public domain worldwide. This software is distributed without any
+# warranty.
+#
+# You should have received a copy of the CC0 Public Domain Dedication
+# along with this software. If not, see
+# <http://creativecommons.org/publicdomain/zero/1.0/>.
+#
+
+fail() {
+  (( $# == 0 )) && batslib_err || batslib_err "$@"
+  return 1
+}
+
+batslib_is_caller() {
+  local -i is_mode_direct=1
+
+  # Handle options.
+  while (( $# > 0 )); do
+    case "$1" in
+      -i|--indirect) is_mode_direct=0; shift ;;
+      --) shift; break ;;
+      *) break ;;
+    esac
+  done
+
+  # Arguments.
+  local -r func="$1"
+
+  # Check call stack.
+  if (( is_mode_direct )); then
+    [[ $func == "${FUNCNAME[2]}" ]] && return 0
+  else
+    local -i depth
+    for (( depth=2; depth<${#FUNCNAME[@]}; ++depth )); do
+      [[ $func == "${FUNCNAME[$depth]}" ]] && return 0
+    done
+  fi
+
+  return 1
+}
+
+batslib_err() {
+  { if (( $# > 0 )); then
+      echo "$@"
+    else
+      cat -
+    fi
+  } >&2
+}
+
+batslib_count_lines() {
+  local -i n_lines=0
+  local line
+  while IFS='' read -r line || [[ -n $line ]]; do
+    (( ++n_lines ))
+  done < <(printf '%s' "$1")
+  echo "$n_lines"
+}
+
+batslib_is_single_line() {
+  for string in "$@"; do
+    (( $(batslib_count_lines "$string") > 1 )) && return 1
+  done
+  return 0
+}
+
+batslib_get_max_single_line_key_width() {
+  local -i max_len=-1
+  while (( $# != 0 )); do
+    local -i key_len="${#1}"
+    batslib_is_single_line "$2" && (( key_len > max_len )) && max_len="$key_len"
+    shift 2
+  done
+  echo "$max_len"
+}
+
+batslib_print_kv_single() {
+  local -ir col_width="$1"; shift
+  while (( $# != 0 )); do
+    printf '%-*s : %s\n' "$col_width" "$1" "$2"
+    shift 2
+  done
+}
+
+batslib_print_kv_multi() {
+  while (( $# != 0 )); do
+    printf '%s (%d lines):\n' "$1" "$( batslib_count_lines "$2" )"
+    printf '%s\n' "$2"
+    shift 2
+  done
+}
+
+batslib_print_kv_single_or_multi() {
+  local -ir width="$1"; shift
+  local -a pairs=( "$@" )
+
+  local -a values=()
+  local -i i
+  for (( i=1; i < ${#pairs[@]}; i+=2 )); do
+    values+=( "${pairs[$i]}" )
+  done
+
+  if batslib_is_single_line "${values[@]}"; then
+    batslib_print_kv_single "$width" "${pairs[@]}"
+  else
+    local -i i
+    for (( i=1; i < ${#pairs[@]}; i+=2 )); do
+      pairs[$i]="$( batslib_prefix < <(printf '%s' "${pairs[$i]}") )"
+    done
+    batslib_print_kv_multi "${pairs[@]}"
+  fi
+}
+
+batslib_prefix() {
+  local -r prefix="${1:-  }"
+  local line
+  while IFS='' read -r line || [[ -n $line ]]; do
+    printf '%s%s\n' "$prefix" "$line"
+  done
+}
+
+batslib_mark() {
+  local -r symbol="$1"; shift
+  # Sort line numbers.
+  set -- $( sort -nu <<< "$( printf '%d\n' "$@" )" )
+
+  local line
+  local -i idx=0
+  while IFS='' read -r line || [[ -n $line ]]; do
+    if (( ${1:--1} == idx )); then
+      printf '%s\n' "${symbol}${line:${#symbol}}"
+      shift
+    else
+      printf '%s\n' "$line"
+    fi
+    (( ++idx ))
+  done
+}
+
+batslib_decorate() {
+  echo
+  echo "-- $1 --"
+  cat -
+  echo '--'
+  echo
+}
+
+############################################################
+
+assert() {
+  if ! "$@"; then
+    batslib_print_kv_single 10 'expression' "$*" \
+    | batslib_decorate 'assertion failed' \
+    | fail
+  fi
+}
+
+assert_equal() {
+  if [[ $1 != "$2" ]]; then
+    batslib_print_kv_single_or_multi 8 \
+    'expected' "$2" \
+    'actual'   "$1" \
+    | batslib_decorate 'values do not equal' \
+    | fail
+  fi
+}
+
+assert_failure() {
+  : "${output?}"
+  : "${status?}"
+
+  (( $# > 0 )) && local -r expected="$1"
+  if (( status == 0 )); then
+    batslib_print_kv_single_or_multi 6 'output' "$output" \
+    | batslib_decorate 'command succeeded, but it was expected to fail' \
+    | fail
+  elif (( $# > 0 )) && (( status != expected )); then
+    { local -ir width=8
+      batslib_print_kv_single "$width" \
+      'expected' "$expected" \
+      'actual'   "$status"
+      batslib_print_kv_single_or_multi "$width" \
+      'output' "$output"
+    } \
+    | batslib_decorate 'command failed as expected, but status differs' \
+    | fail
+  fi
+}
+
+assert_line() {
+  local -i is_match_line=0
+  local -i is_mode_partial=0
+  local -i is_mode_regexp=0
+  : "${lines?}"
+
+  # Handle options.
+  while (( $# > 0 )); do
+    case "$1" in
+    -n|--index)
+      if (( $# < 2 )) || ! [[ $2 =~ ^([0-9]|[1-9][0-9]+)$ ]]; then
+        echo "\`--index' requires an integer argument: \`$2'" \
+        | batslib_decorate 'ERROR: assert_line' \
+        | fail
+        return $?
+      fi
+      is_match_line=1
+      local -ri idx="$2"
+      shift 2
+      ;;
+    -p|--partial) is_mode_partial=1; shift ;;
+    -e|--regexp) is_mode_regexp=1; shift ;;
+    --) shift; break ;;
+    *) break ;;
+    esac
+  done
+
+  if (( is_mode_partial )) && (( is_mode_regexp )); then
+    echo "\`--partial' and \`--regexp' are mutually exclusive" \
+    | batslib_decorate 'ERROR: assert_line' \
+    | fail
+    return $?
+  fi
+
+  # Arguments.
+  local -r expected="$1"
+
+  if (( is_mode_regexp == 1 )) && [[ '' =~ $expected ]] || (( $? == 2 )); then
+    echo "Invalid extended regular expression: \`$expected'" \
+    | batslib_decorate 'ERROR: assert_line' \
+    | fail
+    return $?
+  fi
+
+  # Matching.
+  if (( is_match_line )); then
+    # Specific line.
+    if (( is_mode_regexp )); then
+      if ! [[ ${lines[$idx]} =~ $expected ]]; then
+        batslib_print_kv_single 6 \
+        'index' "$idx" \
+        'regexp' "$expected" \
+        'line'  "${lines[$idx]}" \
+        | batslib_decorate 'regular expression does not match line' \
+        | fail
+      fi
+    elif (( is_mode_partial )); then
+      if [[ ${lines[$idx]} != *"$expected"* ]]; then
+        batslib_print_kv_single 9 \
+        'index'     "$idx" \
+        'substring' "$expected" \
+        'line'      "${lines[$idx]}" \
+        | batslib_decorate 'line does not contain substring' \
+        | fail
+      fi
+    else
+      if [[ ${lines[$idx]} != "$expected" ]]; then
+        batslib_print_kv_single 8 \
+        'index'    "$idx" \
+        'expected' "$expected" \
+        'actual'   "${lines[$idx]}" \
+        | batslib_decorate 'line differs' \
+        | fail
+      fi
+    fi
+  else
+    # Contained in output.
+    if (( is_mode_regexp )); then
+      local -i idx
+      for (( idx = 0; idx < ${#lines[@]}; ++idx )); do
+        [[ ${lines[$idx]} =~ $expected ]] && return 0
+      done
+      { local -ar single=( 'regexp' "$expected" )
+        local -ar may_be_multi=( 'output' "$output" )
+        local -ir width="$( batslib_get_max_single_line_key_width "${single[@]}" "${may_be_multi[@]}" )"
+        batslib_print_kv_single "$width" "${single[@]}"
+        batslib_print_kv_single_or_multi "$width" "${may_be_multi[@]}"
+      } \
+      | batslib_decorate 'no output line matches regular expression' \
+      | fail
+    elif (( is_mode_partial )); then
+      local -i idx
+      for (( idx = 0; idx < ${#lines[@]}; ++idx )); do
+        [[ ${lines[$idx]} == *"$expected"* ]] && return 0
+      done
+      { local -ar single=( 'substring' "$expected" )
+        local -ar may_be_multi=( 'output' "$output" )
+        local -ir width="$( batslib_get_max_single_line_key_width "${single[@]}" "${may_be_multi[@]}" )"
+        batslib_print_kv_single "$width" "${single[@]}"
+        batslib_print_kv_single_or_multi "$width" "${may_be_multi[@]}"
+      } \
+      | batslib_decorate 'no output line contains substring' \
+      | fail
+    else
+      local -i idx
+      for (( idx = 0; idx < ${#lines[@]}; ++idx )); do
+        [[ ${lines[$idx]} == "$expected" ]] && return 0
+      done
+      { local -ar single=( 'line' "$expected" )
+        local -ar may_be_multi=( 'output' "$output" )
+        local -ir width="$( batslib_get_max_single_line_key_width "${single[@]}" "${may_be_multi[@]}" )"
+        batslib_print_kv_single "$width" "${single[@]}"
+        batslib_print_kv_single_or_multi "$width" "${may_be_multi[@]}"
+      } \
+      | batslib_decorate 'output does not contain line' \
+      | fail
+    fi
+  fi
+}
+
+assert_output() {
+  local -i is_mode_partial=0
+  local -i is_mode_regexp=0
+  local -i is_mode_nonempty=0
+  local -i use_stdin=0
+  : "${output?}"
+
+  # Handle options.
+  if (( $# == 0 )); then
+    is_mode_nonempty=1
+  fi
+
+  while (( $# > 0 )); do
+    case "$1" in
+    -p|--partial) is_mode_partial=1; shift ;;
+    -e|--regexp) is_mode_regexp=1; shift ;;
+    -|--stdin) use_stdin=1; shift ;;
+    --) shift; break ;;
+    *) break ;;
+    esac
+  done
+
+  if (( is_mode_partial )) && (( is_mode_regexp )); then
+    echo "\`--partial' and \`--regexp' are mutually exclusive" \
+    | batslib_decorate 'ERROR: assert_output' \
+    | fail
+    return $?
+  fi
+
+  # Arguments.
+  local expected
+  if (( use_stdin )); then
+    expected="$(cat -)"
+  else
+    expected="${1-}"
+  fi
+
+  # Matching.
+  if (( is_mode_nonempty )); then
+    if [ -z "$output" ]; then
+      echo 'expected non-empty output, but output was empty' \
+      | batslib_decorate 'no output' \
+      | fail
+    fi
+  elif (( is_mode_regexp )); then
+    if [[ '' =~ $expected ]] || (( $? == 2 )); then
+      echo "Invalid extended regular expression: \`$expected'" \
+      | batslib_decorate 'ERROR: assert_output' \
+      | fail
+    elif ! [[ $output =~ $expected ]]; then
+      batslib_print_kv_single_or_multi 6 \
+      'regexp'  "$expected" \
+      'output' "$output" \
+      | batslib_decorate 'regular expression does not match output' \
+      | fail
+    fi
+  elif (( is_mode_partial )); then
+    if [[ $output != *"$expected"* ]]; then
+      batslib_print_kv_single_or_multi 9 \
+      'substring' "$expected" \
+      'output'    "$output" \
+      | batslib_decorate 'output does not contain substring' \
+      | fail
+    fi
+  else
+    if [[ $output != "$expected" ]]; then
+      batslib_print_kv_single_or_multi 8 \
+      'expected' "$expected" \
+      'actual'   "$output" \
+      | batslib_decorate 'output differs' \
+      | fail
+    fi
+  fi
+}
+
+assert_success() {
+  : "${output?}"
+  : "${status?}"
+
+  if (( status != 0 )); then
+    { local -ir width=6
+      batslib_print_kv_single "$width" 'status' "$status"
+      batslib_print_kv_single_or_multi "$width" 'output' "$output"
+    } \
+    | batslib_decorate 'command failed' \
+    | fail
+  fi
+}
+
+refute() {
+  if "$@"; then
+    batslib_print_kv_single 10 'expression' "$*" \
+    | batslib_decorate 'assertion succeeded, but it was expected to fail' \
+    | fail
+  fi
+}
+
+refute_line() {
+  local -i is_match_line=0
+  local -i is_mode_partial=0
+  local -i is_mode_regexp=0
+  : "${lines?}"
+
+  # Handle options.
+  while (( $# > 0 )); do
+    case "$1" in
+    -n|--index)
+      if (( $# < 2 )) || ! [[ $2 =~ ^([0-9]|[1-9][0-9]+)$ ]]; then
+        echo "\`--index' requires an integer argument: \`$2'" \
+        | batslib_decorate 'ERROR: refute_line' \
+        | fail
+        return $?
+      fi
+      is_match_line=1
+      local -ri idx="$2"
+      shift 2
+      ;;
+    -p|--partial) is_mode_partial=1; shift ;;
+    -e|--regexp) is_mode_regexp=1; shift ;;
+    --) shift; break ;;
+    *) break ;;
+    esac
+  done
+
+  if (( is_mode_partial )) && (( is_mode_regexp )); then
+    echo "\`--partial' and \`--regexp' are mutually exclusive" \
+    | batslib_decorate 'ERROR: refute_line' \
+    | fail
+    return $?
+  fi
+
+  # Arguments.
+  local -r unexpected="$1"
+
+  if (( is_mode_regexp == 1 )) && [[ '' =~ $unexpected ]] || (( $? == 2 )); then
+    echo "Invalid extended regular expression: \`$unexpected'" \
+    | batslib_decorate 'ERROR: refute_line' \
+    | fail
+    return $?
+  fi
+
+  # Matching.
+  if (( is_match_line )); then
+    # Specific line.
+    if (( is_mode_regexp )); then
+      if [[ ${lines[$idx]} =~ $unexpected ]]; then
+        batslib_print_kv_single 6 \
+        'index' "$idx" \
+        'regexp' "$unexpected" \
+        'line'  "${lines[$idx]}" \
+        | batslib_decorate 'regular expression should not match line' \
+        | fail
+      fi
+    elif (( is_mode_partial )); then
+      if [[ ${lines[$idx]} == *"$unexpected"* ]]; then
+        batslib_print_kv_single 9 \
+        'index'     "$idx" \
+        'substring' "$unexpected" \
+        'line'      "${lines[$idx]}" \
+        | batslib_decorate 'line should not contain substring' \
+        | fail
+      fi
+    else
+      if [[ ${lines[$idx]} == "$unexpected" ]]; then
+        batslib_print_kv_single 5 \
+        'index' "$idx" \
+        'line'  "${lines[$idx]}" \
+        | batslib_decorate 'line should differ' \
+        | fail
+      fi
+    fi
+  else
+    # Line contained in output.
+    if (( is_mode_regexp )); then
+      local -i idx
+      for (( idx = 0; idx < ${#lines[@]}; ++idx )); do
+        if [[ ${lines[$idx]} =~ $unexpected ]]; then
+          { local -ar single=( 'regexp' "$unexpected" 'index' "$idx" )
+            local -a may_be_multi=( 'output' "$output" )
+            local -ir width="$( batslib_get_max_single_line_key_width "${single[@]}" "${may_be_multi[@]}" )"
+            batslib_print_kv_single "$width" "${single[@]}"
+            if batslib_is_single_line "${may_be_multi[1]}"; then
+              batslib_print_kv_single "$width" "${may_be_multi[@]}"
+            else
+              may_be_multi[1]="$( printf '%s' "${may_be_multi[1]}" | batslib_prefix | batslib_mark '>' "$idx" )"
+              batslib_print_kv_multi "${may_be_multi[@]}"
+            fi
+          } \
+          | batslib_decorate 'no line should match the regular expression' \
+          | fail
+          return $?
+        fi
+      done
+    elif (( is_mode_partial )); then
+      local -i idx
+      for (( idx = 0; idx < ${#lines[@]}; ++idx )); do
+        if [[ ${lines[$idx]} == *"$unexpected"* ]]; then
+          { local -ar single=( 'substring' "$unexpected" 'index' "$idx" )
+            local -a may_be_multi=( 'output' "$output" )
+            local -ir width="$( batslib_get_max_single_line_key_width "${single[@]}" "${may_be_multi[@]}" )"
+            batslib_print_kv_single "$width" "${single[@]}"
+            if batslib_is_single_line "${may_be_multi[1]}"; then
+              batslib_print_kv_single "$width" "${may_be_multi[@]}"
+            else
+              may_be_multi[1]="$( printf '%s' "${may_be_multi[1]}" | batslib_prefix | batslib_mark '>' "$idx" )"
+              batslib_print_kv_multi "${may_be_multi[@]}"
+            fi
+          } \
+          | batslib_decorate 'no line should contain substring' \
+          | fail
+          return $?
+        fi
+      done
+    else
+      local -i idx
+      for (( idx = 0; idx < ${#lines[@]}; ++idx )); do
+        if [[ ${lines[$idx]} == "$unexpected" ]]; then
+          { local -ar single=( 'line' "$unexpected" 'index' "$idx" )
+            local -a may_be_multi=( 'output' "$output" )
+            local -ir width="$( batslib_get_max_single_line_key_width "${single[@]}" "${may_be_multi[@]}" )"
+            batslib_print_kv_single "$width" "${single[@]}"
+            if batslib_is_single_line "${may_be_multi[1]}"; then
+              batslib_print_kv_single "$width" "${may_be_multi[@]}"
+            else
+              may_be_multi[1]="$( printf '%s' "${may_be_multi[1]}" | batslib_prefix | batslib_mark '>' "$idx" )"
+              batslib_print_kv_multi "${may_be_multi[@]}"
+            fi
+          } \
+          | batslib_decorate 'line should not be in output' \
+          | fail
+          return $?
+        fi
+      done
+    fi
+  fi
+}
+
+refute_output() {
+  local -i is_mode_partial=0
+  local -i is_mode_regexp=0
+  local -i is_mode_empty=0
+  local -i use_stdin=0
+  : "${output?}"
+
+  # Handle options.
+  if (( $# == 0 )); then
+    is_mode_empty=1
+  fi
+
+  while (( $# > 0 )); do
+    case "$1" in
+    -p|--partial) is_mode_partial=1; shift ;;
+    -e|--regexp) is_mode_regexp=1; shift ;;
+    -|--stdin) use_stdin=1; shift ;;
+    --) shift; break ;;
+    *) break ;;
+    esac
+  done
+
+  if (( is_mode_partial )) && (( is_mode_regexp )); then
+    echo "\`--partial' and \`--regexp' are mutually exclusive" \
+    | batslib_decorate 'ERROR: refute_output' \
+    | fail
+    return $?
+  fi
+
+  # Arguments.
+  local unexpected
+  if (( use_stdin )); then
+    unexpected="$(cat -)"
+  else
+    unexpected="${1-}"
+  fi
+
+  if (( is_mode_regexp == 1 )) && [[ '' =~ $unexpected ]] || (( $? == 2 )); then
+    echo "Invalid extended regular expression: \`$unexpected'" \
+    | batslib_decorate 'ERROR: refute_output' \
+    | fail
+    return $?
+  fi
+
+  # Matching.
+  if (( is_mode_empty )); then
+    if [ -n "$output" ]; then
+      batslib_print_kv_single_or_multi 6 \
+      'output' "$output" \
+      | batslib_decorate 'output non-empty, but expected no output' \
+      | fail
+    fi
+  elif (( is_mode_regexp )); then
+    if [[ $output =~ $unexpected ]]; then
+      batslib_print_kv_single_or_multi 6 \
+      'regexp'  "$unexpected" \
+      'output' "$output" \
+      | batslib_decorate 'regular expression should not match output' \
+      | fail
+    fi
+  elif (( is_mode_partial )); then
+    if [[ $output == *"$unexpected"* ]]; then
+      batslib_print_kv_single_or_multi 9 \
+      'substring' "$unexpected" \
+      'output'    "$output" \
+      | batslib_decorate 'output should not contain substring' \
+      | fail
+    fi
+  else
+    if [[ $output == "$unexpected" ]]; then
+      batslib_print_kv_single_or_multi 6 \
+      'output' "$output" \
+      | batslib_decorate 'output equals, but it was expected to differ' \
+      | fail
+    fi
+  fi
+}
diff --git a/jq/gigasecond/bats-jq.bash b/jq/gigasecond/bats-jq.bash
new file mode 100644
index 0000000..3f55da5
--- /dev/null
+++ b/jq/gigasecond/bats-jq.bash
@@ -0,0 +1,29 @@
+#!/usr/bin/env bash
+#
+# `bats-core` will consume both stdout and stderr for the `run` command's output.
+# However `jq` prints its DEBUG output on stderr.
+#
+# Lines starting with `["DEBUG:",` will be prefixed with a hash and printed on file descriptor 3.
+# Other lines on stderr will remain on stderr for bats to consume.
+#
+# See `bats-core` docs:
+# - "Printing to the terminal", https://bats-core.readthedocs.io/en/stable/writing-tests.html#printing-to-the-terminal
+# - "File descriptor 3", https://bats-core.readthedocs.io/en/stable/writing-tests.html#file-descriptor-3-read-this-if-bats-hangs
+
+
+jq() {
+    local output stderr rc line
+    stderr=$(mktemp)
+    output=$(command jq "$@" 2> "$stderr")
+    rc=$?
+    while IFS= read -r line || [[ -n $line ]]; do
+        if [[ $line == '["DEBUG:",'* ]]; then
+            echo "# $line" >&3
+        else
+            echo "$line" >&2
+        fi
+    done < "$stderr"
+    rm -f "$stderr"
+    echo "$output"
+    return "$rc"
+}
diff --git a/jq/gigasecond/gigasecond.jq b/jq/gigasecond/gigasecond.jq
new file mode 100644
index 0000000..583d649
--- /dev/null
+++ b/jq/gigasecond/gigasecond.jq
@@ -0,0 +1 @@
+.moment + ("Z", "T00:00:00Z")|fromdate? + 1e9 |todate[:-1]
diff --git a/jq/gigasecond/test-gigasecond.bats b/jq/gigasecond/test-gigasecond.bats
new file mode 100644
index 0000000..7434031
--- /dev/null
+++ b/jq/gigasecond/test-gigasecond.bats
@@ -0,0 +1,46 @@
+#!/usr/bin/env bats
+load bats-extra
+load bats-jq
+
+# Ensure date calculations are done using UTC time zone
+export TZ=UTC
+
+@test 'date only specificaion of time' {
+  #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+  run jq -r -f gigasecond.jq <<< '{"moment": "2011-04-25"}'
+
+  assert_success
+  assert_output "2043-01-01T01:46:40"
+}
+
+@test 'second test for date only specification of time' {
+  #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+  run jq -r -f gigasecond.jq <<< '{"moment": "1977-06-13"}'
+
+  assert_success
+  assert_output "2009-02-19T01:46:40"
+}
+
+@test 'third test for date only specification of time' {
+  #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+  run jq -r -f gigasecond.jq <<< '{"moment": "1959-07-19"}'
+
+  assert_success
+  assert_output "1991-03-27T01:46:40"
+}
+
+@test 'full time specified' {
+  #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+  run jq -r -f gigasecond.jq <<< '{"moment": "2015-01-24T22:00:00"}'
+
+  assert_success
+  assert_output "2046-10-02T23:46:40"
+}
+
+@test 'full time with day roll-over' {
+  #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+  run jq -r -f gigasecond.jq <<< '{"moment": "2015-01-24T23:59:59"}'
+
+  assert_success
+  assert_output "2046-10-03T01:46:39"
+}
diff --git a/jq/nucleotide-count/.exercism/config.json b/jq/nucleotide-count/.exercism/config.json
new file mode 100644
index 0000000..a261dc5
--- /dev/null
+++ b/jq/nucleotide-count/.exercism/config.json
@@ -0,0 +1,19 @@
+{
+  "authors": [
+    "glennj"
+  ],
+  "files": {
+    "solution": [
+      "nucleotide-count.jq"
+    ],
+    "test": [
+      "test-nucleotide-count.bats"
+    ],
+    "example": [
+      ".meta/example.jq"
+    ]
+  },
+  "blurb": "Given a DNA string, compute how many times each nucleotide occurs in the string.",
+  "source": "The Calculating DNA Nucleotides_problem at Rosalind",
+  "source_url": "https://rosalind.info/problems/dna/"
+}
diff --git a/jq/nucleotide-count/.exercism/metadata.json b/jq/nucleotide-count/.exercism/metadata.json
new file mode 100644
index 0000000..7b26a81
--- /dev/null
+++ b/jq/nucleotide-count/.exercism/metadata.json
@@ -0,0 +1 @@
+{"track":"jq","exercise":"nucleotide-count","id":"9d5bdac393f1422ebe94b4857abe6276","url":"https://exercism.org/tracks/jq/exercises/nucleotide-count","handle":"cafkafk","is_requester":true,"auto_approve":false}
\ No newline at end of file
diff --git a/jq/nucleotide-count/HELP.md b/jq/nucleotide-count/HELP.md
new file mode 100644
index 0000000..a25c90f
--- /dev/null
+++ b/jq/nucleotide-count/HELP.md
@@ -0,0 +1,114 @@
+# Help
+
+## Running the tests
+
+Each exercise contains a test file.
+Run the tests using the `bats` program.
+
+```bash
+bats test-hello-world.bats
+```
+
+`bats` will need to be installed.
+See the [Testing on the Bash track][bash] page for instructions to install `bats` for your system.
+
+### bats is implemented in bash
+
+The bats file is a bash script, with some special functions recognized by the `bats` command.
+You'll see some tests that look like
+
+```sh
+jq -f some-exercise.jq <<< "{some,json,here}"
+```
+
+That `<<<` syntax is a bash [Here String][here-string].
+It sends the string on the right-hand side into the standard input of the program on the left-hand side.
+It is ([approximately][so]) the same as
+
+```sh
+echo "{some,json,here}" | jq -f some-exercise.jq
+```
+
+## Help for assert functions
+
+The tests use functions from the [bats-assert][bats-assert] library.
+Help for the various `assert*` functions can be found there.
+
+## Skipped tests
+
+Solving an exercise means making all its tests pass.
+By default, only one test (the first one) is executed when you run the tests.
+This is intentional, as it allows you to focus on just making that one test pass.
+Once it passes, you can enable the next test by commenting out or removing the
+
+    [[ $BATS_RUN_SKIPPED == true ]] || skip
+
+annotations prepending other tests.
+
+## Overriding skips
+
+To run all tests, including the ones with `skip` annotations, you can run:
+
+```bash
+BATS_RUN_SKIPPED=true bats test-some-exercise.bats
+```
+
+It can be convenient to use a wrapper function to save on typing: in `bash` you can do:
+
+```bash
+bats() {
+    BATS_RUN_SKIPPED=true command bats *.bats
+}
+```
+
+Then run tests with just:
+
+```bash
+bats
+```
+
+## Debugging in `jq`
+
+`jq` comes with a handy [`debug`][debug] filter.
+Use it while you are developing your exercise solutions to inspect the data that is currently in the jq pipline.
+See the [debugging doc][debugging] for more details.
+
+
+[bash]: https://exercism.org/docs/tracks/bash/tests
+[bats-assert]: https://github.com/bats-core/bats-assert
+[here-string]: https://www.gnu.org/software/bash/manual/bash.html#Here-Strings
+[so]: https://unix.stackexchange.com/a/80372/4667
+[debug]: https://jqlang.github.io/jq/manual/v1.7/#debug
+[debugging]: https://exercism.org/docs/tracks/jq/debugging
+
+## Submitting your solution
+
+You can submit your solution using the `exercism submit nucleotide-count.jq` command.
+This command will upload your solution to the Exercism website and print the solution page's URL.
+
+It's possible to submit an incomplete solution which allows you to:
+
+- See how others have completed the exercise
+- Request help from a mentor
+
+## Need to get help?
+
+If you'd like help solving the exercise, check the following pages:
+
+- The [jq track's documentation](https://exercism.org/docs/tracks/jq)
+- The [jq track's programming category on the forum](https://forum.exercism.org/c/programming/jq)
+- [Exercism's programming category on the forum](https://forum.exercism.org/c/programming/5)
+- The [Frequently Asked Questions](https://exercism.org/docs/using/faqs)
+
+Should those resources not suffice, you could submit your (incomplete) solution to request mentoring.
+
+## Need more help?
+
+- Go to the [Exercism Community forum](https://forum.exercism.org) to get support and ask questions (or just chat!)
+  - Use the [Exercism Support](https://forum.exercism.org/c/support/8) category if you face any issues with working in the web editor, or downloading or submitting your exercises locally.
+  - Use the [Programming:jq](https://forum.exercism.org/c/programming/jq/133) category for jq-specific topics.
+- Join the community on [Exercism's Discord server](https://exercism.org/r/discord).
+- [StackOverflow](https://stackoverflow.com/questions/tagged/jq) can be used to search for your problem and see if it has been answered already.
+  You can also ask and answer questions.
+- [Github issue tracker](https://github.com/exercism/jq/issues) is where we track our development and maintainance of `jq` exercises in exercism.
+  If none of the above links help you, feel free to post an issue here.
\ No newline at end of file
diff --git a/jq/nucleotide-count/README.md b/jq/nucleotide-count/README.md
new file mode 100644
index 0000000..4fcbbef
--- /dev/null
+++ b/jq/nucleotide-count/README.md
@@ -0,0 +1,38 @@
+# Nucleotide Count
+
+Welcome to Nucleotide Count on Exercism's jq Track.
+If you need help running the tests or submitting your code, check out `HELP.md`.
+
+## Instructions
+
+Each of us inherits from our biological parents a set of chemical instructions known as DNA that influence how our bodies are constructed.
+All known life depends on DNA!
+
+> Note: You do not need to understand anything about nucleotides or DNA to complete this exercise.
+
+DNA is a long chain of other chemicals and the most important are the four nucleotides, adenine, cytosine, guanine and thymine.
+A single DNA chain can contain billions of these four nucleotides and the order in which they occur is important!
+We call the order of these nucleotides in a bit of DNA a "DNA sequence".
+
+We represent a DNA sequence as an ordered collection of these four nucleotides and a common way to do that is with a string of characters such as "ATTACG" for a DNA sequence of 6 nucleotides.
+'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' for thymine.
+
+Given a string representing a DNA sequence, count how many of each nucleotide is present.
+If the string contains characters that aren't A, C, G, or T then it is invalid and you should signal an error.
+
+For example:
+
+```text
+"GATTACA" -> 'A': 3, 'C': 1, 'G': 1, 'T': 2
+"INVALID" -> error
+```
+
+## Source
+
+### Created by
+
+- @glennj
+
+### Based on
+
+The Calculating DNA Nucleotides_problem at Rosalind - https://rosalind.info/problems/dna/
\ No newline at end of file
diff --git a/jq/nucleotide-count/bats-extra.bash b/jq/nucleotide-count/bats-extra.bash
new file mode 100644
index 0000000..54d4807
--- /dev/null
+++ b/jq/nucleotide-count/bats-extra.bash
@@ -0,0 +1,637 @@
+# This is the source code for bats-support and bats-assert, concatenated
+# * https://github.com/bats-core/bats-support
+# * https://github.com/bats-core/bats-assert
+#
+# Comments have been removed to save space. See the git repos for full source code.
+
+############################################################
+#
+# bats-support - Supporting library for Bats test helpers
+#
+# Written in 2016 by Zoltan Tombol <zoltan dot tombol at gmail dot com>
+#
+# To the extent possible under law, the author(s) have dedicated all
+# copyright and related and neighboring rights to this software to the
+# public domain worldwide. This software is distributed without any
+# warranty.
+#
+# You should have received a copy of the CC0 Public Domain Dedication
+# along with this software. If not, see
+# <http://creativecommons.org/publicdomain/zero/1.0/>.
+#
+
+fail() {
+  (( $# == 0 )) && batslib_err || batslib_err "$@"
+  return 1
+}
+
+batslib_is_caller() {
+  local -i is_mode_direct=1
+
+  # Handle options.
+  while (( $# > 0 )); do
+    case "$1" in
+      -i|--indirect) is_mode_direct=0; shift ;;
+      --) shift; break ;;
+      *) break ;;
+    esac
+  done
+
+  # Arguments.
+  local -r func="$1"
+
+  # Check call stack.
+  if (( is_mode_direct )); then
+    [[ $func == "${FUNCNAME[2]}" ]] && return 0
+  else
+    local -i depth
+    for (( depth=2; depth<${#FUNCNAME[@]}; ++depth )); do
+      [[ $func == "${FUNCNAME[$depth]}" ]] && return 0
+    done
+  fi
+
+  return 1
+}
+
+batslib_err() {
+  { if (( $# > 0 )); then
+      echo "$@"
+    else
+      cat -
+    fi
+  } >&2
+}
+
+batslib_count_lines() {
+  local -i n_lines=0
+  local line
+  while IFS='' read -r line || [[ -n $line ]]; do
+    (( ++n_lines ))
+  done < <(printf '%s' "$1")
+  echo "$n_lines"
+}
+
+batslib_is_single_line() {
+  for string in "$@"; do
+    (( $(batslib_count_lines "$string") > 1 )) && return 1
+  done
+  return 0
+}
+
+batslib_get_max_single_line_key_width() {
+  local -i max_len=-1
+  while (( $# != 0 )); do
+    local -i key_len="${#1}"
+    batslib_is_single_line "$2" && (( key_len > max_len )) && max_len="$key_len"
+    shift 2
+  done
+  echo "$max_len"
+}
+
+batslib_print_kv_single() {
+  local -ir col_width="$1"; shift
+  while (( $# != 0 )); do
+    printf '%-*s : %s\n' "$col_width" "$1" "$2"
+    shift 2
+  done
+}
+
+batslib_print_kv_multi() {
+  while (( $# != 0 )); do
+    printf '%s (%d lines):\n' "$1" "$( batslib_count_lines "$2" )"
+    printf '%s\n' "$2"
+    shift 2
+  done
+}
+
+batslib_print_kv_single_or_multi() {
+  local -ir width="$1"; shift
+  local -a pairs=( "$@" )
+
+  local -a values=()
+  local -i i
+  for (( i=1; i < ${#pairs[@]}; i+=2 )); do
+    values+=( "${pairs[$i]}" )
+  done
+
+  if batslib_is_single_line "${values[@]}"; then
+    batslib_print_kv_single "$width" "${pairs[@]}"
+  else
+    local -i i
+    for (( i=1; i < ${#pairs[@]}; i+=2 )); do
+      pairs[$i]="$( batslib_prefix < <(printf '%s' "${pairs[$i]}") )"
+    done
+    batslib_print_kv_multi "${pairs[@]}"
+  fi
+}
+
+batslib_prefix() {
+  local -r prefix="${1:-  }"
+  local line
+  while IFS='' read -r line || [[ -n $line ]]; do
+    printf '%s%s\n' "$prefix" "$line"
+  done
+}
+
+batslib_mark() {
+  local -r symbol="$1"; shift
+  # Sort line numbers.
+  set -- $( sort -nu <<< "$( printf '%d\n' "$@" )" )
+
+  local line
+  local -i idx=0
+  while IFS='' read -r line || [[ -n $line ]]; do
+    if (( ${1:--1} == idx )); then
+      printf '%s\n' "${symbol}${line:${#symbol}}"
+      shift
+    else
+      printf '%s\n' "$line"
+    fi
+    (( ++idx ))
+  done
+}
+
+batslib_decorate() {
+  echo
+  echo "-- $1 --"
+  cat -
+  echo '--'
+  echo
+}
+
+############################################################
+
+assert() {
+  if ! "$@"; then
+    batslib_print_kv_single 10 'expression' "$*" \
+    | batslib_decorate 'assertion failed' \
+    | fail
+  fi
+}
+
+assert_equal() {
+  if [[ $1 != "$2" ]]; then
+    batslib_print_kv_single_or_multi 8 \
+    'expected' "$2" \
+    'actual'   "$1" \
+    | batslib_decorate 'values do not equal' \
+    | fail
+  fi
+}
+
+assert_failure() {
+  : "${output?}"
+  : "${status?}"
+
+  (( $# > 0 )) && local -r expected="$1"
+  if (( status == 0 )); then
+    batslib_print_kv_single_or_multi 6 'output' "$output" \
+    | batslib_decorate 'command succeeded, but it was expected to fail' \
+    | fail
+  elif (( $# > 0 )) && (( status != expected )); then
+    { local -ir width=8
+      batslib_print_kv_single "$width" \
+      'expected' "$expected" \
+      'actual'   "$status"
+      batslib_print_kv_single_or_multi "$width" \
+      'output' "$output"
+    } \
+    | batslib_decorate 'command failed as expected, but status differs' \
+    | fail
+  fi
+}
+
+assert_line() {
+  local -i is_match_line=0
+  local -i is_mode_partial=0
+  local -i is_mode_regexp=0
+  : "${lines?}"
+
+  # Handle options.
+  while (( $# > 0 )); do
+    case "$1" in
+    -n|--index)
+      if (( $# < 2 )) || ! [[ $2 =~ ^([0-9]|[1-9][0-9]+)$ ]]; then
+        echo "\`--index' requires an integer argument: \`$2'" \
+        | batslib_decorate 'ERROR: assert_line' \
+        | fail
+        return $?
+      fi
+      is_match_line=1
+      local -ri idx="$2"
+      shift 2
+      ;;
+    -p|--partial) is_mode_partial=1; shift ;;
+    -e|--regexp) is_mode_regexp=1; shift ;;
+    --) shift; break ;;
+    *) break ;;
+    esac
+  done
+
+  if (( is_mode_partial )) && (( is_mode_regexp )); then
+    echo "\`--partial' and \`--regexp' are mutually exclusive" \
+    | batslib_decorate 'ERROR: assert_line' \
+    | fail
+    return $?
+  fi
+
+  # Arguments.
+  local -r expected="$1"
+
+  if (( is_mode_regexp == 1 )) && [[ '' =~ $expected ]] || (( $? == 2 )); then
+    echo "Invalid extended regular expression: \`$expected'" \
+    | batslib_decorate 'ERROR: assert_line' \
+    | fail
+    return $?
+  fi
+
+  # Matching.
+  if (( is_match_line )); then
+    # Specific line.
+    if (( is_mode_regexp )); then
+      if ! [[ ${lines[$idx]} =~ $expected ]]; then
+        batslib_print_kv_single 6 \
+        'index' "$idx" \
+        'regexp' "$expected" \
+        'line'  "${lines[$idx]}" \
+        | batslib_decorate 'regular expression does not match line' \
+        | fail
+      fi
+    elif (( is_mode_partial )); then
+      if [[ ${lines[$idx]} != *"$expected"* ]]; then
+        batslib_print_kv_single 9 \
+        'index'     "$idx" \
+        'substring' "$expected" \
+        'line'      "${lines[$idx]}" \
+        | batslib_decorate 'line does not contain substring' \
+        | fail
+      fi
+    else
+      if [[ ${lines[$idx]} != "$expected" ]]; then
+        batslib_print_kv_single 8 \
+        'index'    "$idx" \
+        'expected' "$expected" \
+        'actual'   "${lines[$idx]}" \
+        | batslib_decorate 'line differs' \
+        | fail
+      fi
+    fi
+  else
+    # Contained in output.
+    if (( is_mode_regexp )); then
+      local -i idx
+      for (( idx = 0; idx < ${#lines[@]}; ++idx )); do
+        [[ ${lines[$idx]} =~ $expected ]] && return 0
+      done
+      { local -ar single=( 'regexp' "$expected" )
+        local -ar may_be_multi=( 'output' "$output" )
+        local -ir width="$( batslib_get_max_single_line_key_width "${single[@]}" "${may_be_multi[@]}" )"
+        batslib_print_kv_single "$width" "${single[@]}"
+        batslib_print_kv_single_or_multi "$width" "${may_be_multi[@]}"
+      } \
+      | batslib_decorate 'no output line matches regular expression' \
+      | fail
+    elif (( is_mode_partial )); then
+      local -i idx
+      for (( idx = 0; idx < ${#lines[@]}; ++idx )); do
+        [[ ${lines[$idx]} == *"$expected"* ]] && return 0
+      done
+      { local -ar single=( 'substring' "$expected" )
+        local -ar may_be_multi=( 'output' "$output" )
+        local -ir width="$( batslib_get_max_single_line_key_width "${single[@]}" "${may_be_multi[@]}" )"
+        batslib_print_kv_single "$width" "${single[@]}"
+        batslib_print_kv_single_or_multi "$width" "${may_be_multi[@]}"
+      } \
+      | batslib_decorate 'no output line contains substring' \
+      | fail
+    else
+      local -i idx
+      for (( idx = 0; idx < ${#lines[@]}; ++idx )); do
+        [[ ${lines[$idx]} == "$expected" ]] && return 0
+      done
+      { local -ar single=( 'line' "$expected" )
+        local -ar may_be_multi=( 'output' "$output" )
+        local -ir width="$( batslib_get_max_single_line_key_width "${single[@]}" "${may_be_multi[@]}" )"
+        batslib_print_kv_single "$width" "${single[@]}"
+        batslib_print_kv_single_or_multi "$width" "${may_be_multi[@]}"
+      } \
+      | batslib_decorate 'output does not contain line' \
+      | fail
+    fi
+  fi
+}
+
+assert_output() {
+  local -i is_mode_partial=0
+  local -i is_mode_regexp=0
+  local -i is_mode_nonempty=0
+  local -i use_stdin=0
+  : "${output?}"
+
+  # Handle options.
+  if (( $# == 0 )); then
+    is_mode_nonempty=1
+  fi
+
+  while (( $# > 0 )); do
+    case "$1" in
+    -p|--partial) is_mode_partial=1; shift ;;
+    -e|--regexp) is_mode_regexp=1; shift ;;
+    -|--stdin) use_stdin=1; shift ;;
+    --) shift; break ;;
+    *) break ;;
+    esac
+  done
+
+  if (( is_mode_partial )) && (( is_mode_regexp )); then
+    echo "\`--partial' and \`--regexp' are mutually exclusive" \
+    | batslib_decorate 'ERROR: assert_output' \
+    | fail
+    return $?
+  fi
+
+  # Arguments.
+  local expected
+  if (( use_stdin )); then
+    expected="$(cat -)"
+  else
+    expected="${1-}"
+  fi
+
+  # Matching.
+  if (( is_mode_nonempty )); then
+    if [ -z "$output" ]; then
+      echo 'expected non-empty output, but output was empty' \
+      | batslib_decorate 'no output' \
+      | fail
+    fi
+  elif (( is_mode_regexp )); then
+    if [[ '' =~ $expected ]] || (( $? == 2 )); then
+      echo "Invalid extended regular expression: \`$expected'" \
+      | batslib_decorate 'ERROR: assert_output' \
+      | fail
+    elif ! [[ $output =~ $expected ]]; then
+      batslib_print_kv_single_or_multi 6 \
+      'regexp'  "$expected" \
+      'output' "$output" \
+      | batslib_decorate 'regular expression does not match output' \
+      | fail
+    fi
+  elif (( is_mode_partial )); then
+    if [[ $output != *"$expected"* ]]; then
+      batslib_print_kv_single_or_multi 9 \
+      'substring' "$expected" \
+      'output'    "$output" \
+      | batslib_decorate 'output does not contain substring' \
+      | fail
+    fi
+  else
+    if [[ $output != "$expected" ]]; then
+      batslib_print_kv_single_or_multi 8 \
+      'expected' "$expected" \
+      'actual'   "$output" \
+      | batslib_decorate 'output differs' \
+      | fail
+    fi
+  fi
+}
+
+assert_success() {
+  : "${output?}"
+  : "${status?}"
+
+  if (( status != 0 )); then
+    { local -ir width=6
+      batslib_print_kv_single "$width" 'status' "$status"
+      batslib_print_kv_single_or_multi "$width" 'output' "$output"
+    } \
+    | batslib_decorate 'command failed' \
+    | fail
+  fi
+}
+
+refute() {
+  if "$@"; then
+    batslib_print_kv_single 10 'expression' "$*" \
+    | batslib_decorate 'assertion succeeded, but it was expected to fail' \
+    | fail
+  fi
+}
+
+refute_line() {
+  local -i is_match_line=0
+  local -i is_mode_partial=0
+  local -i is_mode_regexp=0
+  : "${lines?}"
+
+  # Handle options.
+  while (( $# > 0 )); do
+    case "$1" in
+    -n|--index)
+      if (( $# < 2 )) || ! [[ $2 =~ ^([0-9]|[1-9][0-9]+)$ ]]; then
+        echo "\`--index' requires an integer argument: \`$2'" \
+        | batslib_decorate 'ERROR: refute_line' \
+        | fail
+        return $?
+      fi
+      is_match_line=1
+      local -ri idx="$2"
+      shift 2
+      ;;
+    -p|--partial) is_mode_partial=1; shift ;;
+    -e|--regexp) is_mode_regexp=1; shift ;;
+    --) shift; break ;;
+    *) break ;;
+    esac
+  done
+
+  if (( is_mode_partial )) && (( is_mode_regexp )); then
+    echo "\`--partial' and \`--regexp' are mutually exclusive" \
+    | batslib_decorate 'ERROR: refute_line' \
+    | fail
+    return $?
+  fi
+
+  # Arguments.
+  local -r unexpected="$1"
+
+  if (( is_mode_regexp == 1 )) && [[ '' =~ $unexpected ]] || (( $? == 2 )); then
+    echo "Invalid extended regular expression: \`$unexpected'" \
+    | batslib_decorate 'ERROR: refute_line' \
+    | fail
+    return $?
+  fi
+
+  # Matching.
+  if (( is_match_line )); then
+    # Specific line.
+    if (( is_mode_regexp )); then
+      if [[ ${lines[$idx]} =~ $unexpected ]]; then
+        batslib_print_kv_single 6 \
+        'index' "$idx" \
+        'regexp' "$unexpected" \
+        'line'  "${lines[$idx]}" \
+        | batslib_decorate 'regular expression should not match line' \
+        | fail
+      fi
+    elif (( is_mode_partial )); then
+      if [[ ${lines[$idx]} == *"$unexpected"* ]]; then
+        batslib_print_kv_single 9 \
+        'index'     "$idx" \
+        'substring' "$unexpected" \
+        'line'      "${lines[$idx]}" \
+        | batslib_decorate 'line should not contain substring' \
+        | fail
+      fi
+    else
+      if [[ ${lines[$idx]} == "$unexpected" ]]; then
+        batslib_print_kv_single 5 \
+        'index' "$idx" \
+        'line'  "${lines[$idx]}" \
+        | batslib_decorate 'line should differ' \
+        | fail
+      fi
+    fi
+  else
+    # Line contained in output.
+    if (( is_mode_regexp )); then
+      local -i idx
+      for (( idx = 0; idx < ${#lines[@]}; ++idx )); do
+        if [[ ${lines[$idx]} =~ $unexpected ]]; then
+          { local -ar single=( 'regexp' "$unexpected" 'index' "$idx" )
+            local -a may_be_multi=( 'output' "$output" )
+            local -ir width="$( batslib_get_max_single_line_key_width "${single[@]}" "${may_be_multi[@]}" )"
+            batslib_print_kv_single "$width" "${single[@]}"
+            if batslib_is_single_line "${may_be_multi[1]}"; then
+              batslib_print_kv_single "$width" "${may_be_multi[@]}"
+            else
+              may_be_multi[1]="$( printf '%s' "${may_be_multi[1]}" | batslib_prefix | batslib_mark '>' "$idx" )"
+              batslib_print_kv_multi "${may_be_multi[@]}"
+            fi
+          } \
+          | batslib_decorate 'no line should match the regular expression' \
+          | fail
+          return $?
+        fi
+      done
+    elif (( is_mode_partial )); then
+      local -i idx
+      for (( idx = 0; idx < ${#lines[@]}; ++idx )); do
+        if [[ ${lines[$idx]} == *"$unexpected"* ]]; then
+          { local -ar single=( 'substring' "$unexpected" 'index' "$idx" )
+            local -a may_be_multi=( 'output' "$output" )
+            local -ir width="$( batslib_get_max_single_line_key_width "${single[@]}" "${may_be_multi[@]}" )"
+            batslib_print_kv_single "$width" "${single[@]}"
+            if batslib_is_single_line "${may_be_multi[1]}"; then
+              batslib_print_kv_single "$width" "${may_be_multi[@]}"
+            else
+              may_be_multi[1]="$( printf '%s' "${may_be_multi[1]}" | batslib_prefix | batslib_mark '>' "$idx" )"
+              batslib_print_kv_multi "${may_be_multi[@]}"
+            fi
+          } \
+          | batslib_decorate 'no line should contain substring' \
+          | fail
+          return $?
+        fi
+      done
+    else
+      local -i idx
+      for (( idx = 0; idx < ${#lines[@]}; ++idx )); do
+        if [[ ${lines[$idx]} == "$unexpected" ]]; then
+          { local -ar single=( 'line' "$unexpected" 'index' "$idx" )
+            local -a may_be_multi=( 'output' "$output" )
+            local -ir width="$( batslib_get_max_single_line_key_width "${single[@]}" "${may_be_multi[@]}" )"
+            batslib_print_kv_single "$width" "${single[@]}"
+            if batslib_is_single_line "${may_be_multi[1]}"; then
+              batslib_print_kv_single "$width" "${may_be_multi[@]}"
+            else
+              may_be_multi[1]="$( printf '%s' "${may_be_multi[1]}" | batslib_prefix | batslib_mark '>' "$idx" )"
+              batslib_print_kv_multi "${may_be_multi[@]}"
+            fi
+          } \
+          | batslib_decorate 'line should not be in output' \
+          | fail
+          return $?
+        fi
+      done
+    fi
+  fi
+}
+
+refute_output() {
+  local -i is_mode_partial=0
+  local -i is_mode_regexp=0
+  local -i is_mode_empty=0
+  local -i use_stdin=0
+  : "${output?}"
+
+  # Handle options.
+  if (( $# == 0 )); then
+    is_mode_empty=1
+  fi
+
+  while (( $# > 0 )); do
+    case "$1" in
+    -p|--partial) is_mode_partial=1; shift ;;
+    -e|--regexp) is_mode_regexp=1; shift ;;
+    -|--stdin) use_stdin=1; shift ;;
+    --) shift; break ;;
+    *) break ;;
+    esac
+  done
+
+  if (( is_mode_partial )) && (( is_mode_regexp )); then
+    echo "\`--partial' and \`--regexp' are mutually exclusive" \
+    | batslib_decorate 'ERROR: refute_output' \
+    | fail
+    return $?
+  fi
+
+  # Arguments.
+  local unexpected
+  if (( use_stdin )); then
+    unexpected="$(cat -)"
+  else
+    unexpected="${1-}"
+  fi
+
+  if (( is_mode_regexp == 1 )) && [[ '' =~ $unexpected ]] || (( $? == 2 )); then
+    echo "Invalid extended regular expression: \`$unexpected'" \
+    | batslib_decorate 'ERROR: refute_output' \
+    | fail
+    return $?
+  fi
+
+  # Matching.
+  if (( is_mode_empty )); then
+    if [ -n "$output" ]; then
+      batslib_print_kv_single_or_multi 6 \
+      'output' "$output" \
+      | batslib_decorate 'output non-empty, but expected no output' \
+      | fail
+    fi
+  elif (( is_mode_regexp )); then
+    if [[ $output =~ $unexpected ]]; then
+      batslib_print_kv_single_or_multi 6 \
+      'regexp'  "$unexpected" \
+      'output' "$output" \
+      | batslib_decorate 'regular expression should not match output' \
+      | fail
+    fi
+  elif (( is_mode_partial )); then
+    if [[ $output == *"$unexpected"* ]]; then
+      batslib_print_kv_single_or_multi 9 \
+      'substring' "$unexpected" \
+      'output'    "$output" \
+      | batslib_decorate 'output should not contain substring' \
+      | fail
+    fi
+  else
+    if [[ $output == "$unexpected" ]]; then
+      batslib_print_kv_single_or_multi 6 \
+      'output' "$output" \
+      | batslib_decorate 'output equals, but it was expected to differ' \
+      | fail
+    fi
+  fi
+}
diff --git a/jq/nucleotide-count/bats-jq.bash b/jq/nucleotide-count/bats-jq.bash
new file mode 100644
index 0000000..3f55da5
--- /dev/null
+++ b/jq/nucleotide-count/bats-jq.bash
@@ -0,0 +1,29 @@
+#!/usr/bin/env bash
+#
+# `bats-core` will consume both stdout and stderr for the `run` command's output.
+# However `jq` prints its DEBUG output on stderr.
+#
+# Lines starting with `["DEBUG:",` will be prefixed with a hash and printed on file descriptor 3.
+# Other lines on stderr will remain on stderr for bats to consume.
+#
+# See `bats-core` docs:
+# - "Printing to the terminal", https://bats-core.readthedocs.io/en/stable/writing-tests.html#printing-to-the-terminal
+# - "File descriptor 3", https://bats-core.readthedocs.io/en/stable/writing-tests.html#file-descriptor-3-read-this-if-bats-hangs
+
+
+jq() {
+    local output stderr rc line
+    stderr=$(mktemp)
+    output=$(command jq "$@" 2> "$stderr")
+    rc=$?
+    while IFS= read -r line || [[ -n $line ]]; do
+        if [[ $line == '["DEBUG:",'* ]]; then
+            echo "# $line" >&3
+        else
+            echo "$line" >&2
+        fi
+    done < "$stderr"
+    rm -f "$stderr"
+    echo "$output"
+    return "$rc"
+}
diff --git a/jq/nucleotide-count/nucleotide-count.jq b/jq/nucleotide-count/nucleotide-count.jq
new file mode 100644
index 0000000..8cc578b
--- /dev/null
+++ b/jq/nucleotide-count/nucleotide-count.jq
@@ -0,0 +1,9 @@
+.strand
+  | reduce (.|ascii_upcase/"")[] as $n
+  (
+    {A: 0, C: 0, G: 0, T: 0};
+    if .|has("\($n)")
+    then .["\($n)"] += 1
+    else "Invalid nucleotide in strand"|halt_error
+    end
+  )
diff --git a/jq/nucleotide-count/test-nucleotide-count.bats b/jq/nucleotide-count/test-nucleotide-count.bats
new file mode 100644
index 0000000..80b27c4
--- /dev/null
+++ b/jq/nucleotide-count/test-nucleotide-count.bats
@@ -0,0 +1,83 @@
+#!/usr/bin/env bats
+# generated on 2023-11-07T18:49:21Z
+load bats-extra
+load bats-jq
+
+assert_objects_equal() {
+    local result=$(
+        jq -n --argjson actual "$1" \
+              --argjson expected "$2" \
+            '$actual == $expected'
+    )
+    [[ $result == "true" ]]
+}
+
+@test 'empty strand' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -c -f nucleotide-count.jq << 'END_INPUT'
+        {
+          "strand": ""
+        }
+END_INPUT
+
+    assert_success
+    expected='{"A":0,"C":0,"G":0,"T":0}'
+    assert_objects_equal "$output" "$expected"
+}
+
+@test 'can count one nucleotide in single-character input' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -c -f nucleotide-count.jq << 'END_INPUT'
+        {
+          "strand": "G"
+        }
+END_INPUT
+
+    assert_success
+    expected='{"A":0,"C":0,"G":1,"T":0}'
+    assert_objects_equal "$output" "$expected"
+}
+
+@test 'strand with repeated nucleotide' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -c -f nucleotide-count.jq << 'END_INPUT'
+        {
+          "strand": "GGGGGGG"
+        }
+END_INPUT
+
+    assert_success
+    expected='{"A":0,"C":0,"G":7,"T":0}'
+    assert_objects_equal "$output" "$expected"
+}
+
+@test 'strand with multiple nucleotides' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -c -f nucleotide-count.jq << 'END_INPUT'
+        {
+          "strand": "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"
+        }
+END_INPUT
+
+    assert_success
+    expected='{"A":20,"C":12,"G":17,"T":21}'
+    assert_objects_equal "$output" "$expected"
+}
+
+@test 'strand with invalid nucleotides' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -c -f nucleotide-count.jq << 'END_INPUT'
+        {
+          "strand": "AGXXACT"
+        }
+END_INPUT
+
+    assert_failure
+    expected='Invalid nucleotide in strand'
+    assert_equal "$output" "$expected"
+}
diff --git a/jq/raindrops/.exercism/config.json b/jq/raindrops/.exercism/config.json
new file mode 100644
index 0000000..2ca661a
--- /dev/null
+++ b/jq/raindrops/.exercism/config.json
@@ -0,0 +1,19 @@
+{
+  "authors": [
+    "glennj"
+  ],
+  "files": {
+    "solution": [
+      "raindrops.jq"
+    ],
+    "test": [
+      "test-raindrops.bats"
+    ],
+    "example": [
+      ".meta/example.jq"
+    ]
+  },
+  "blurb": "Convert a number into its corresponding raindrop sounds - Pling, Plang and Plong.",
+  "source": "A variation on FizzBuzz, a famous technical interview question that is intended to weed out potential candidates. That question is itself derived from Fizz Buzz, a popular children's game for teaching division.",
+  "source_url": "https://en.wikipedia.org/wiki/Fizz_buzz"
+}
diff --git a/jq/raindrops/.exercism/metadata.json b/jq/raindrops/.exercism/metadata.json
new file mode 100644
index 0000000..b5ad757
--- /dev/null
+++ b/jq/raindrops/.exercism/metadata.json
@@ -0,0 +1 @@
+{"track":"jq","exercise":"raindrops","id":"1d143aafe4324f8785666c5181bc576f","url":"https://exercism.org/tracks/jq/exercises/raindrops","handle":"cafkafk","is_requester":true,"auto_approve":false}
\ No newline at end of file
diff --git a/jq/raindrops/HELP.md b/jq/raindrops/HELP.md
new file mode 100644
index 0000000..fea7215
--- /dev/null
+++ b/jq/raindrops/HELP.md
@@ -0,0 +1,114 @@
+# Help
+
+## Running the tests
+
+Each exercise contains a test file.
+Run the tests using the `bats` program.
+
+```bash
+bats test-hello-world.bats
+```
+
+`bats` will need to be installed.
+See the [Testing on the Bash track][bash] page for instructions to install `bats` for your system.
+
+### bats is implemented in bash
+
+The bats file is a bash script, with some special functions recognized by the `bats` command.
+You'll see some tests that look like
+
+```sh
+jq -f some-exercise.jq <<< "{some,json,here}"
+```
+
+That `<<<` syntax is a bash [Here String][here-string].
+It sends the string on the right-hand side into the standard input of the program on the left-hand side.
+It is ([approximately][so]) the same as
+
+```sh
+echo "{some,json,here}" | jq -f some-exercise.jq
+```
+
+## Help for assert functions
+
+The tests use functions from the [bats-assert][bats-assert] library.
+Help for the various `assert*` functions can be found there.
+
+## Skipped tests
+
+Solving an exercise means making all its tests pass.
+By default, only one test (the first one) is executed when you run the tests.
+This is intentional, as it allows you to focus on just making that one test pass.
+Once it passes, you can enable the next test by commenting out or removing the
+
+    [[ $BATS_RUN_SKIPPED == true ]] || skip
+
+annotations prepending other tests.
+
+## Overriding skips
+
+To run all tests, including the ones with `skip` annotations, you can run:
+
+```bash
+BATS_RUN_SKIPPED=true bats test-some-exercise.bats
+```
+
+It can be convenient to use a wrapper function to save on typing: in `bash` you can do:
+
+```bash
+bats() {
+    BATS_RUN_SKIPPED=true command bats *.bats
+}
+```
+
+Then run tests with just:
+
+```bash
+bats
+```
+
+## Debugging in `jq`
+
+`jq` comes with a handy [`debug`][debug] filter.
+Use it while you are developing your exercise solutions to inspect the data that is currently in the jq pipline.
+See the [debugging doc][debugging] for more details.
+
+
+[bash]: https://exercism.org/docs/tracks/bash/tests
+[bats-assert]: https://github.com/bats-core/bats-assert
+[here-string]: https://www.gnu.org/software/bash/manual/bash.html#Here-Strings
+[so]: https://unix.stackexchange.com/a/80372/4667
+[debug]: https://jqlang.github.io/jq/manual/v1.7/#debug
+[debugging]: https://exercism.org/docs/tracks/jq/debugging
+
+## Submitting your solution
+
+You can submit your solution using the `exercism submit raindrops.jq` command.
+This command will upload your solution to the Exercism website and print the solution page's URL.
+
+It's possible to submit an incomplete solution which allows you to:
+
+- See how others have completed the exercise
+- Request help from a mentor
+
+## Need to get help?
+
+If you'd like help solving the exercise, check the following pages:
+
+- The [jq track's documentation](https://exercism.org/docs/tracks/jq)
+- The [jq track's programming category on the forum](https://forum.exercism.org/c/programming/jq)
+- [Exercism's programming category on the forum](https://forum.exercism.org/c/programming/5)
+- The [Frequently Asked Questions](https://exercism.org/docs/using/faqs)
+
+Should those resources not suffice, you could submit your (incomplete) solution to request mentoring.
+
+## Need more help?
+
+- Go to the [Exercism Community forum](https://forum.exercism.org) to get support and ask questions (or just chat!)
+  - Use the [Exercism Support](https://forum.exercism.org/c/support/8) category if you face any issues with working in the web editor, or downloading or submitting your exercises locally.
+  - Use the [Programming:jq](https://forum.exercism.org/c/programming/jq/133) category for jq-specific topics.
+- Join the community on [Exercism's Discord server](https://exercism.org/r/discord).
+- [StackOverflow](https://stackoverflow.com/questions/tagged/jq) can be used to search for your problem and see if it has been answered already.
+  You can also ask and answer questions.
+- [Github issue tracker](https://github.com/exercism/jq/issues) is where we track our development and maintainance of `jq` exercises in exercism.
+  If none of the above links help you, feel free to post an issue here.
\ No newline at end of file
diff --git a/jq/raindrops/README.md b/jq/raindrops/README.md
new file mode 100644
index 0000000..8a33b0b
--- /dev/null
+++ b/jq/raindrops/README.md
@@ -0,0 +1,66 @@
+# Raindrops
+
+Welcome to Raindrops on Exercism's jq Track.
+If you need help running the tests or submitting your code, check out `HELP.md`.
+
+## Introduction
+
+Raindrops is a slightly more complex version of the FizzBuzz challenge, a classic interview question.
+
+## Instructions
+
+Your task is to convert a number into its corresponding raindrop sounds.
+
+If a given number:
+
+- is divisible by 3, add "Pling" to the result.
+- is divisible by 5, add "Plang" to the result.
+- is divisible by 7, add "Plong" to the result.
+- **is not** divisible by 3, 5, or 7, the result should be the number as a string.
+
+## Examples
+
+- 28 is divisible by 7, but not 3 or 5, so the result would be `"Plong"`.
+- 30 is divisible by 3 and 5, but not 7, so the result would be `"PlingPlang"`.
+- 34 is not divisible by 3, 5, or 7, so the result would be `"34"`.
+
+~~~~exercism/note
+A common way to test if one number is evenly divisible by another is to compare the [remainder][remainder] or [modulus][modulo] to zero.
+Most languages provide operators or functions for one (or both) of these.
+
+[remainder]: https://exercism.org/docs/programming/operators/remainder
+[modulo]: https://en.wikipedia.org/wiki/Modulo_operation
+~~~~
+
+## `jq` Tips
+
+The [`if-then-else` expression][if] will be helpful in this exercise.
+
+An example:
+
+```jq
+8, 10, 12 | if . < 10 then "\(.) is less than ten"
+            elif . > 10 then "\(.) is more than ten"
+            else "\(.) equals ten"
+            end
+```
+
+outputs
+
+```json
+"8 is less than ten"
+"10 equals ten"
+"12 is more than ten"
+```
+
+[if]: https://jqlang.github.io/jq/manual/v1.7/#if-then-else-end
+
+## Source
+
+### Created by
+
+- @glennj
+
+### Based on
+
+A variation on FizzBuzz, a famous technical interview question that is intended to weed out potential candidates. That question is itself derived from Fizz Buzz, a popular children's game for teaching division. - https://en.wikipedia.org/wiki/Fizz_buzz
\ No newline at end of file
diff --git a/jq/raindrops/bats-extra.bash b/jq/raindrops/bats-extra.bash
new file mode 100644
index 0000000..54d4807
--- /dev/null
+++ b/jq/raindrops/bats-extra.bash
@@ -0,0 +1,637 @@
+# This is the source code for bats-support and bats-assert, concatenated
+# * https://github.com/bats-core/bats-support
+# * https://github.com/bats-core/bats-assert
+#
+# Comments have been removed to save space. See the git repos for full source code.
+
+############################################################
+#
+# bats-support - Supporting library for Bats test helpers
+#
+# Written in 2016 by Zoltan Tombol <zoltan dot tombol at gmail dot com>
+#
+# To the extent possible under law, the author(s) have dedicated all
+# copyright and related and neighboring rights to this software to the
+# public domain worldwide. This software is distributed without any
+# warranty.
+#
+# You should have received a copy of the CC0 Public Domain Dedication
+# along with this software. If not, see
+# <http://creativecommons.org/publicdomain/zero/1.0/>.
+#
+
+fail() {
+  (( $# == 0 )) && batslib_err || batslib_err "$@"
+  return 1
+}
+
+batslib_is_caller() {
+  local -i is_mode_direct=1
+
+  # Handle options.
+  while (( $# > 0 )); do
+    case "$1" in
+      -i|--indirect) is_mode_direct=0; shift ;;
+      --) shift; break ;;
+      *) break ;;
+    esac
+  done
+
+  # Arguments.
+  local -r func="$1"
+
+  # Check call stack.
+  if (( is_mode_direct )); then
+    [[ $func == "${FUNCNAME[2]}" ]] && return 0
+  else
+    local -i depth
+    for (( depth=2; depth<${#FUNCNAME[@]}; ++depth )); do
+      [[ $func == "${FUNCNAME[$depth]}" ]] && return 0
+    done
+  fi
+
+  return 1
+}
+
+batslib_err() {
+  { if (( $# > 0 )); then
+      echo "$@"
+    else
+      cat -
+    fi
+  } >&2
+}
+
+batslib_count_lines() {
+  local -i n_lines=0
+  local line
+  while IFS='' read -r line || [[ -n $line ]]; do
+    (( ++n_lines ))
+  done < <(printf '%s' "$1")
+  echo "$n_lines"
+}
+
+batslib_is_single_line() {
+  for string in "$@"; do
+    (( $(batslib_count_lines "$string") > 1 )) && return 1
+  done
+  return 0
+}
+
+batslib_get_max_single_line_key_width() {
+  local -i max_len=-1
+  while (( $# != 0 )); do
+    local -i key_len="${#1}"
+    batslib_is_single_line "$2" && (( key_len > max_len )) && max_len="$key_len"
+    shift 2
+  done
+  echo "$max_len"
+}
+
+batslib_print_kv_single() {
+  local -ir col_width="$1"; shift
+  while (( $# != 0 )); do
+    printf '%-*s : %s\n' "$col_width" "$1" "$2"
+    shift 2
+  done
+}
+
+batslib_print_kv_multi() {
+  while (( $# != 0 )); do
+    printf '%s (%d lines):\n' "$1" "$( batslib_count_lines "$2" )"
+    printf '%s\n' "$2"
+    shift 2
+  done
+}
+
+batslib_print_kv_single_or_multi() {
+  local -ir width="$1"; shift
+  local -a pairs=( "$@" )
+
+  local -a values=()
+  local -i i
+  for (( i=1; i < ${#pairs[@]}; i+=2 )); do
+    values+=( "${pairs[$i]}" )
+  done
+
+  if batslib_is_single_line "${values[@]}"; then
+    batslib_print_kv_single "$width" "${pairs[@]}"
+  else
+    local -i i
+    for (( i=1; i < ${#pairs[@]}; i+=2 )); do
+      pairs[$i]="$( batslib_prefix < <(printf '%s' "${pairs[$i]}") )"
+    done
+    batslib_print_kv_multi "${pairs[@]}"
+  fi
+}
+
+batslib_prefix() {
+  local -r prefix="${1:-  }"
+  local line
+  while IFS='' read -r line || [[ -n $line ]]; do
+    printf '%s%s\n' "$prefix" "$line"
+  done
+}
+
+batslib_mark() {
+  local -r symbol="$1"; shift
+  # Sort line numbers.
+  set -- $( sort -nu <<< "$( printf '%d\n' "$@" )" )
+
+  local line
+  local -i idx=0
+  while IFS='' read -r line || [[ -n $line ]]; do
+    if (( ${1:--1} == idx )); then
+      printf '%s\n' "${symbol}${line:${#symbol}}"
+      shift
+    else
+      printf '%s\n' "$line"
+    fi
+    (( ++idx ))
+  done
+}
+
+batslib_decorate() {
+  echo
+  echo "-- $1 --"
+  cat -
+  echo '--'
+  echo
+}
+
+############################################################
+
+assert() {
+  if ! "$@"; then
+    batslib_print_kv_single 10 'expression' "$*" \
+    | batslib_decorate 'assertion failed' \
+    | fail
+  fi
+}
+
+assert_equal() {
+  if [[ $1 != "$2" ]]; then
+    batslib_print_kv_single_or_multi 8 \
+    'expected' "$2" \
+    'actual'   "$1" \
+    | batslib_decorate 'values do not equal' \
+    | fail
+  fi
+}
+
+assert_failure() {
+  : "${output?}"
+  : "${status?}"
+
+  (( $# > 0 )) && local -r expected="$1"
+  if (( status == 0 )); then
+    batslib_print_kv_single_or_multi 6 'output' "$output" \
+    | batslib_decorate 'command succeeded, but it was expected to fail' \
+    | fail
+  elif (( $# > 0 )) && (( status != expected )); then
+    { local -ir width=8
+      batslib_print_kv_single "$width" \
+      'expected' "$expected" \
+      'actual'   "$status"
+      batslib_print_kv_single_or_multi "$width" \
+      'output' "$output"
+    } \
+    | batslib_decorate 'command failed as expected, but status differs' \
+    | fail
+  fi
+}
+
+assert_line() {
+  local -i is_match_line=0
+  local -i is_mode_partial=0
+  local -i is_mode_regexp=0
+  : "${lines?}"
+
+  # Handle options.
+  while (( $# > 0 )); do
+    case "$1" in
+    -n|--index)
+      if (( $# < 2 )) || ! [[ $2 =~ ^([0-9]|[1-9][0-9]+)$ ]]; then
+        echo "\`--index' requires an integer argument: \`$2'" \
+        | batslib_decorate 'ERROR: assert_line' \
+        | fail
+        return $?
+      fi
+      is_match_line=1
+      local -ri idx="$2"
+      shift 2
+      ;;
+    -p|--partial) is_mode_partial=1; shift ;;
+    -e|--regexp) is_mode_regexp=1; shift ;;
+    --) shift; break ;;
+    *) break ;;
+    esac
+  done
+
+  if (( is_mode_partial )) && (( is_mode_regexp )); then
+    echo "\`--partial' and \`--regexp' are mutually exclusive" \
+    | batslib_decorate 'ERROR: assert_line' \
+    | fail
+    return $?
+  fi
+
+  # Arguments.
+  local -r expected="$1"
+
+  if (( is_mode_regexp == 1 )) && [[ '' =~ $expected ]] || (( $? == 2 )); then
+    echo "Invalid extended regular expression: \`$expected'" \
+    | batslib_decorate 'ERROR: assert_line' \
+    | fail
+    return $?
+  fi
+
+  # Matching.
+  if (( is_match_line )); then
+    # Specific line.
+    if (( is_mode_regexp )); then
+      if ! [[ ${lines[$idx]} =~ $expected ]]; then
+        batslib_print_kv_single 6 \
+        'index' "$idx" \
+        'regexp' "$expected" \
+        'line'  "${lines[$idx]}" \
+        | batslib_decorate 'regular expression does not match line' \
+        | fail
+      fi
+    elif (( is_mode_partial )); then
+      if [[ ${lines[$idx]} != *"$expected"* ]]; then
+        batslib_print_kv_single 9 \
+        'index'     "$idx" \
+        'substring' "$expected" \
+        'line'      "${lines[$idx]}" \
+        | batslib_decorate 'line does not contain substring' \
+        | fail
+      fi
+    else
+      if [[ ${lines[$idx]} != "$expected" ]]; then
+        batslib_print_kv_single 8 \
+        'index'    "$idx" \
+        'expected' "$expected" \
+        'actual'   "${lines[$idx]}" \
+        | batslib_decorate 'line differs' \
+        | fail
+      fi
+    fi
+  else
+    # Contained in output.
+    if (( is_mode_regexp )); then
+      local -i idx
+      for (( idx = 0; idx < ${#lines[@]}; ++idx )); do
+        [[ ${lines[$idx]} =~ $expected ]] && return 0
+      done
+      { local -ar single=( 'regexp' "$expected" )
+        local -ar may_be_multi=( 'output' "$output" )
+        local -ir width="$( batslib_get_max_single_line_key_width "${single[@]}" "${may_be_multi[@]}" )"
+        batslib_print_kv_single "$width" "${single[@]}"
+        batslib_print_kv_single_or_multi "$width" "${may_be_multi[@]}"
+      } \
+      | batslib_decorate 'no output line matches regular expression' \
+      | fail
+    elif (( is_mode_partial )); then
+      local -i idx
+      for (( idx = 0; idx < ${#lines[@]}; ++idx )); do
+        [[ ${lines[$idx]} == *"$expected"* ]] && return 0
+      done
+      { local -ar single=( 'substring' "$expected" )
+        local -ar may_be_multi=( 'output' "$output" )
+        local -ir width="$( batslib_get_max_single_line_key_width "${single[@]}" "${may_be_multi[@]}" )"
+        batslib_print_kv_single "$width" "${single[@]}"
+        batslib_print_kv_single_or_multi "$width" "${may_be_multi[@]}"
+      } \
+      | batslib_decorate 'no output line contains substring' \
+      | fail
+    else
+      local -i idx
+      for (( idx = 0; idx < ${#lines[@]}; ++idx )); do
+        [[ ${lines[$idx]} == "$expected" ]] && return 0
+      done
+      { local -ar single=( 'line' "$expected" )
+        local -ar may_be_multi=( 'output' "$output" )
+        local -ir width="$( batslib_get_max_single_line_key_width "${single[@]}" "${may_be_multi[@]}" )"
+        batslib_print_kv_single "$width" "${single[@]}"
+        batslib_print_kv_single_or_multi "$width" "${may_be_multi[@]}"
+      } \
+      | batslib_decorate 'output does not contain line' \
+      | fail
+    fi
+  fi
+}
+
+assert_output() {
+  local -i is_mode_partial=0
+  local -i is_mode_regexp=0
+  local -i is_mode_nonempty=0
+  local -i use_stdin=0
+  : "${output?}"
+
+  # Handle options.
+  if (( $# == 0 )); then
+    is_mode_nonempty=1
+  fi
+
+  while (( $# > 0 )); do
+    case "$1" in
+    -p|--partial) is_mode_partial=1; shift ;;
+    -e|--regexp) is_mode_regexp=1; shift ;;
+    -|--stdin) use_stdin=1; shift ;;
+    --) shift; break ;;
+    *) break ;;
+    esac
+  done
+
+  if (( is_mode_partial )) && (( is_mode_regexp )); then
+    echo "\`--partial' and \`--regexp' are mutually exclusive" \
+    | batslib_decorate 'ERROR: assert_output' \
+    | fail
+    return $?
+  fi
+
+  # Arguments.
+  local expected
+  if (( use_stdin )); then
+    expected="$(cat -)"
+  else
+    expected="${1-}"
+  fi
+
+  # Matching.
+  if (( is_mode_nonempty )); then
+    if [ -z "$output" ]; then
+      echo 'expected non-empty output, but output was empty' \
+      | batslib_decorate 'no output' \
+      | fail
+    fi
+  elif (( is_mode_regexp )); then
+    if [[ '' =~ $expected ]] || (( $? == 2 )); then
+      echo "Invalid extended regular expression: \`$expected'" \
+      | batslib_decorate 'ERROR: assert_output' \
+      | fail
+    elif ! [[ $output =~ $expected ]]; then
+      batslib_print_kv_single_or_multi 6 \
+      'regexp'  "$expected" \
+      'output' "$output" \
+      | batslib_decorate 'regular expression does not match output' \
+      | fail
+    fi
+  elif (( is_mode_partial )); then
+    if [[ $output != *"$expected"* ]]; then
+      batslib_print_kv_single_or_multi 9 \
+      'substring' "$expected" \
+      'output'    "$output" \
+      | batslib_decorate 'output does not contain substring' \
+      | fail
+    fi
+  else
+    if [[ $output != "$expected" ]]; then
+      batslib_print_kv_single_or_multi 8 \
+      'expected' "$expected" \
+      'actual'   "$output" \
+      | batslib_decorate 'output differs' \
+      | fail
+    fi
+  fi
+}
+
+assert_success() {
+  : "${output?}"
+  : "${status?}"
+
+  if (( status != 0 )); then
+    { local -ir width=6
+      batslib_print_kv_single "$width" 'status' "$status"
+      batslib_print_kv_single_or_multi "$width" 'output' "$output"
+    } \
+    | batslib_decorate 'command failed' \
+    | fail
+  fi
+}
+
+refute() {
+  if "$@"; then
+    batslib_print_kv_single 10 'expression' "$*" \
+    | batslib_decorate 'assertion succeeded, but it was expected to fail' \
+    | fail
+  fi
+}
+
+refute_line() {
+  local -i is_match_line=0
+  local -i is_mode_partial=0
+  local -i is_mode_regexp=0
+  : "${lines?}"
+
+  # Handle options.
+  while (( $# > 0 )); do
+    case "$1" in
+    -n|--index)
+      if (( $# < 2 )) || ! [[ $2 =~ ^([0-9]|[1-9][0-9]+)$ ]]; then
+        echo "\`--index' requires an integer argument: \`$2'" \
+        | batslib_decorate 'ERROR: refute_line' \
+        | fail
+        return $?
+      fi
+      is_match_line=1
+      local -ri idx="$2"
+      shift 2
+      ;;
+    -p|--partial) is_mode_partial=1; shift ;;
+    -e|--regexp) is_mode_regexp=1; shift ;;
+    --) shift; break ;;
+    *) break ;;
+    esac
+  done
+
+  if (( is_mode_partial )) && (( is_mode_regexp )); then
+    echo "\`--partial' and \`--regexp' are mutually exclusive" \
+    | batslib_decorate 'ERROR: refute_line' \
+    | fail
+    return $?
+  fi
+
+  # Arguments.
+  local -r unexpected="$1"
+
+  if (( is_mode_regexp == 1 )) && [[ '' =~ $unexpected ]] || (( $? == 2 )); then
+    echo "Invalid extended regular expression: \`$unexpected'" \
+    | batslib_decorate 'ERROR: refute_line' \
+    | fail
+    return $?
+  fi
+
+  # Matching.
+  if (( is_match_line )); then
+    # Specific line.
+    if (( is_mode_regexp )); then
+      if [[ ${lines[$idx]} =~ $unexpected ]]; then
+        batslib_print_kv_single 6 \
+        'index' "$idx" \
+        'regexp' "$unexpected" \
+        'line'  "${lines[$idx]}" \
+        | batslib_decorate 'regular expression should not match line' \
+        | fail
+      fi
+    elif (( is_mode_partial )); then
+      if [[ ${lines[$idx]} == *"$unexpected"* ]]; then
+        batslib_print_kv_single 9 \
+        'index'     "$idx" \
+        'substring' "$unexpected" \
+        'line'      "${lines[$idx]}" \
+        | batslib_decorate 'line should not contain substring' \
+        | fail
+      fi
+    else
+      if [[ ${lines[$idx]} == "$unexpected" ]]; then
+        batslib_print_kv_single 5 \
+        'index' "$idx" \
+        'line'  "${lines[$idx]}" \
+        | batslib_decorate 'line should differ' \
+        | fail
+      fi
+    fi
+  else
+    # Line contained in output.
+    if (( is_mode_regexp )); then
+      local -i idx
+      for (( idx = 0; idx < ${#lines[@]}; ++idx )); do
+        if [[ ${lines[$idx]} =~ $unexpected ]]; then
+          { local -ar single=( 'regexp' "$unexpected" 'index' "$idx" )
+            local -a may_be_multi=( 'output' "$output" )
+            local -ir width="$( batslib_get_max_single_line_key_width "${single[@]}" "${may_be_multi[@]}" )"
+            batslib_print_kv_single "$width" "${single[@]}"
+            if batslib_is_single_line "${may_be_multi[1]}"; then
+              batslib_print_kv_single "$width" "${may_be_multi[@]}"
+            else
+              may_be_multi[1]="$( printf '%s' "${may_be_multi[1]}" | batslib_prefix | batslib_mark '>' "$idx" )"
+              batslib_print_kv_multi "${may_be_multi[@]}"
+            fi
+          } \
+          | batslib_decorate 'no line should match the regular expression' \
+          | fail
+          return $?
+        fi
+      done
+    elif (( is_mode_partial )); then
+      local -i idx
+      for (( idx = 0; idx < ${#lines[@]}; ++idx )); do
+        if [[ ${lines[$idx]} == *"$unexpected"* ]]; then
+          { local -ar single=( 'substring' "$unexpected" 'index' "$idx" )
+            local -a may_be_multi=( 'output' "$output" )
+            local -ir width="$( batslib_get_max_single_line_key_width "${single[@]}" "${may_be_multi[@]}" )"
+            batslib_print_kv_single "$width" "${single[@]}"
+            if batslib_is_single_line "${may_be_multi[1]}"; then
+              batslib_print_kv_single "$width" "${may_be_multi[@]}"
+            else
+              may_be_multi[1]="$( printf '%s' "${may_be_multi[1]}" | batslib_prefix | batslib_mark '>' "$idx" )"
+              batslib_print_kv_multi "${may_be_multi[@]}"
+            fi
+          } \
+          | batslib_decorate 'no line should contain substring' \
+          | fail
+          return $?
+        fi
+      done
+    else
+      local -i idx
+      for (( idx = 0; idx < ${#lines[@]}; ++idx )); do
+        if [[ ${lines[$idx]} == "$unexpected" ]]; then
+          { local -ar single=( 'line' "$unexpected" 'index' "$idx" )
+            local -a may_be_multi=( 'output' "$output" )
+            local -ir width="$( batslib_get_max_single_line_key_width "${single[@]}" "${may_be_multi[@]}" )"
+            batslib_print_kv_single "$width" "${single[@]}"
+            if batslib_is_single_line "${may_be_multi[1]}"; then
+              batslib_print_kv_single "$width" "${may_be_multi[@]}"
+            else
+              may_be_multi[1]="$( printf '%s' "${may_be_multi[1]}" | batslib_prefix | batslib_mark '>' "$idx" )"
+              batslib_print_kv_multi "${may_be_multi[@]}"
+            fi
+          } \
+          | batslib_decorate 'line should not be in output' \
+          | fail
+          return $?
+        fi
+      done
+    fi
+  fi
+}
+
+refute_output() {
+  local -i is_mode_partial=0
+  local -i is_mode_regexp=0
+  local -i is_mode_empty=0
+  local -i use_stdin=0
+  : "${output?}"
+
+  # Handle options.
+  if (( $# == 0 )); then
+    is_mode_empty=1
+  fi
+
+  while (( $# > 0 )); do
+    case "$1" in
+    -p|--partial) is_mode_partial=1; shift ;;
+    -e|--regexp) is_mode_regexp=1; shift ;;
+    -|--stdin) use_stdin=1; shift ;;
+    --) shift; break ;;
+    *) break ;;
+    esac
+  done
+
+  if (( is_mode_partial )) && (( is_mode_regexp )); then
+    echo "\`--partial' and \`--regexp' are mutually exclusive" \
+    | batslib_decorate 'ERROR: refute_output' \
+    | fail
+    return $?
+  fi
+
+  # Arguments.
+  local unexpected
+  if (( use_stdin )); then
+    unexpected="$(cat -)"
+  else
+    unexpected="${1-}"
+  fi
+
+  if (( is_mode_regexp == 1 )) && [[ '' =~ $unexpected ]] || (( $? == 2 )); then
+    echo "Invalid extended regular expression: \`$unexpected'" \
+    | batslib_decorate 'ERROR: refute_output' \
+    | fail
+    return $?
+  fi
+
+  # Matching.
+  if (( is_mode_empty )); then
+    if [ -n "$output" ]; then
+      batslib_print_kv_single_or_multi 6 \
+      'output' "$output" \
+      | batslib_decorate 'output non-empty, but expected no output' \
+      | fail
+    fi
+  elif (( is_mode_regexp )); then
+    if [[ $output =~ $unexpected ]]; then
+      batslib_print_kv_single_or_multi 6 \
+      'regexp'  "$unexpected" \
+      'output' "$output" \
+      | batslib_decorate 'regular expression should not match output' \
+      | fail
+    fi
+  elif (( is_mode_partial )); then
+    if [[ $output == *"$unexpected"* ]]; then
+      batslib_print_kv_single_or_multi 9 \
+      'substring' "$unexpected" \
+      'output'    "$output" \
+      | batslib_decorate 'output should not contain substring' \
+      | fail
+    fi
+  else
+    if [[ $output == "$unexpected" ]]; then
+      batslib_print_kv_single_or_multi 6 \
+      'output' "$output" \
+      | batslib_decorate 'output equals, but it was expected to differ' \
+      | fail
+    fi
+  fi
+}
diff --git a/jq/raindrops/bats-jq.bash b/jq/raindrops/bats-jq.bash
new file mode 100644
index 0000000..3f55da5
--- /dev/null
+++ b/jq/raindrops/bats-jq.bash
@@ -0,0 +1,29 @@
+#!/usr/bin/env bash
+#
+# `bats-core` will consume both stdout and stderr for the `run` command's output.
+# However `jq` prints its DEBUG output on stderr.
+#
+# Lines starting with `["DEBUG:",` will be prefixed with a hash and printed on file descriptor 3.
+# Other lines on stderr will remain on stderr for bats to consume.
+#
+# See `bats-core` docs:
+# - "Printing to the terminal", https://bats-core.readthedocs.io/en/stable/writing-tests.html#printing-to-the-terminal
+# - "File descriptor 3", https://bats-core.readthedocs.io/en/stable/writing-tests.html#file-descriptor-3-read-this-if-bats-hangs
+
+
+jq() {
+    local output stderr rc line
+    stderr=$(mktemp)
+    output=$(command jq "$@" 2> "$stderr")
+    rc=$?
+    while IFS= read -r line || [[ -n $line ]]; do
+        if [[ $line == '["DEBUG:",'* ]]; then
+            echo "# $line" >&3
+        else
+            echo "$line" >&2
+        fi
+    done < "$stderr"
+    rm -f "$stderr"
+    echo "$output"
+    return "$rc"
+}
diff --git a/jq/raindrops/raindrops.jq b/jq/raindrops/raindrops.jq
new file mode 100644
index 0000000..10c224f
--- /dev/null
+++ b/jq/raindrops/raindrops.jq
@@ -0,0 +1 @@
+.number|([if . % 3 == 0 then "Pling" else null end, if . % 5 == 0 then "Plang" else null end, if . % 7 == 0 then "Plong" else null end]|add) // .
diff --git a/jq/raindrops/test-raindrops.bats b/jq/raindrops/test-raindrops.bats
new file mode 100644
index 0000000..99b2ae4
--- /dev/null
+++ b/jq/raindrops/test-raindrops.bats
@@ -0,0 +1,257 @@
+#!/usr/bin/env bats
+# generated on 2022-11-02T20:59:38Z
+load bats-extra
+load bats-jq
+
+@test 'the sound for 1 is 1' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -r -f raindrops.jq << 'END_INPUT'
+        {
+          "number": 1
+        }
+END_INPUT
+
+    assert_success
+    expected='1'
+    assert_equal "$output" "$expected"
+}
+
+@test 'the sound for 3 is Pling' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -r -f raindrops.jq << 'END_INPUT'
+        {
+          "number": 3
+        }
+END_INPUT
+
+    assert_success
+    expected='Pling'
+    assert_equal "$output" "$expected"
+}
+
+@test 'the sound for 5 is Plang' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -r -f raindrops.jq << 'END_INPUT'
+        {
+          "number": 5
+        }
+END_INPUT
+
+    assert_success
+    expected='Plang'
+    assert_equal "$output" "$expected"
+}
+
+@test 'the sound for 7 is Plong' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -r -f raindrops.jq << 'END_INPUT'
+        {
+          "number": 7
+        }
+END_INPUT
+
+    assert_success
+    expected='Plong'
+    assert_equal "$output" "$expected"
+}
+
+@test 'the sound for 6 is Pling as it has a factor 3' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -r -f raindrops.jq << 'END_INPUT'
+        {
+          "number": 6
+        }
+END_INPUT
+
+    assert_success
+    expected='Pling'
+    assert_equal "$output" "$expected"
+}
+
+@test '2 to the power 3 does not make a raindrop sound as 3 is the exponent not the base' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -r -f raindrops.jq << 'END_INPUT'
+        {
+          "number": 8
+        }
+END_INPUT
+
+    assert_success
+    expected='8'
+    assert_equal "$output" "$expected"
+}
+
+@test 'the sound for 9 is Pling as it has a factor 3' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -r -f raindrops.jq << 'END_INPUT'
+        {
+          "number": 9
+        }
+END_INPUT
+
+    assert_success
+    expected='Pling'
+    assert_equal "$output" "$expected"
+}
+
+@test 'the sound for 10 is Plang as it has a factor 5' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -r -f raindrops.jq << 'END_INPUT'
+        {
+          "number": 10
+        }
+END_INPUT
+
+    assert_success
+    expected='Plang'
+    assert_equal "$output" "$expected"
+}
+
+@test 'the sound for 14 is Plong as it has a factor of 7' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -r -f raindrops.jq << 'END_INPUT'
+        {
+          "number": 14
+        }
+END_INPUT
+
+    assert_success
+    expected='Plong'
+    assert_equal "$output" "$expected"
+}
+
+@test 'the sound for 15 is PlingPlang as it has factors 3 and 5' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -r -f raindrops.jq << 'END_INPUT'
+        {
+          "number": 15
+        }
+END_INPUT
+
+    assert_success
+    expected='PlingPlang'
+    assert_equal "$output" "$expected"
+}
+
+@test 'the sound for 21 is PlingPlong as it has factors 3 and 7' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -r -f raindrops.jq << 'END_INPUT'
+        {
+          "number": 21
+        }
+END_INPUT
+
+    assert_success
+    expected='PlingPlong'
+    assert_equal "$output" "$expected"
+}
+
+@test 'the sound for 25 is Plang as it has a factor 5' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -r -f raindrops.jq << 'END_INPUT'
+        {
+          "number": 25
+        }
+END_INPUT
+
+    assert_success
+    expected='Plang'
+    assert_equal "$output" "$expected"
+}
+
+@test 'the sound for 27 is Pling as it has a factor 3' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -r -f raindrops.jq << 'END_INPUT'
+        {
+          "number": 27
+        }
+END_INPUT
+
+    assert_success
+    expected='Pling'
+    assert_equal "$output" "$expected"
+}
+
+@test 'the sound for 35 is PlangPlong as it has factors 5 and 7' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -r -f raindrops.jq << 'END_INPUT'
+        {
+          "number": 35
+        }
+END_INPUT
+
+    assert_success
+    expected='PlangPlong'
+    assert_equal "$output" "$expected"
+}
+
+@test 'the sound for 49 is Plong as it has a factor 7' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -r -f raindrops.jq << 'END_INPUT'
+        {
+          "number": 49
+        }
+END_INPUT
+
+    assert_success
+    expected='Plong'
+    assert_equal "$output" "$expected"
+}
+
+@test 'the sound for 52 is 52' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -r -f raindrops.jq << 'END_INPUT'
+        {
+          "number": 52
+        }
+END_INPUT
+
+    assert_success
+    expected='52'
+    assert_equal "$output" "$expected"
+}
+
+@test 'the sound for 105 is PlingPlangPlong as it has factors 3, 5 and 7' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -r -f raindrops.jq << 'END_INPUT'
+        {
+          "number": 105
+        }
+END_INPUT
+
+    assert_success
+    expected='PlingPlangPlong'
+    assert_equal "$output" "$expected"
+}
+
+@test 'the sound for 3125 is Plang as it has a factor 5' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -r -f raindrops.jq << 'END_INPUT'
+        {
+          "number": 3125
+        }
+END_INPUT
+
+    assert_success
+    expected='Plang'
+    assert_equal "$output" "$expected"
+}
+
diff --git a/jq/space-age/.exercism/config.json b/jq/space-age/.exercism/config.json
new file mode 100644
index 0000000..0ec202e
--- /dev/null
+++ b/jq/space-age/.exercism/config.json
@@ -0,0 +1,19 @@
+{
+  "authors": [
+    "glennj"
+  ],
+  "files": {
+    "solution": [
+      "space-age.jq"
+    ],
+    "test": [
+      "test-space-age.bats"
+    ],
+    "example": [
+      ".meta/example.jq"
+    ]
+  },
+  "blurb": "Given an age in seconds, calculate how old someone is in terms of a given planet's solar years.",
+  "source": "Partially inspired by Chapter 1 in Chris Pine's online Learn to Program tutorial.",
+  "source_url": "https://pine.fm/LearnToProgram/?Chapter=01"
+}
diff --git a/jq/space-age/.exercism/metadata.json b/jq/space-age/.exercism/metadata.json
new file mode 100644
index 0000000..cc3882f
--- /dev/null
+++ b/jq/space-age/.exercism/metadata.json
@@ -0,0 +1 @@
+{"track":"jq","exercise":"space-age","id":"70c9dce079bf441eb8f777fa8f20b1d5","url":"https://exercism.org/tracks/jq/exercises/space-age","handle":"cafkafk","is_requester":true,"auto_approve":false}
\ No newline at end of file
diff --git a/jq/space-age/HELP.md b/jq/space-age/HELP.md
new file mode 100644
index 0000000..9304648
--- /dev/null
+++ b/jq/space-age/HELP.md
@@ -0,0 +1,114 @@
+# Help
+
+## Running the tests
+
+Each exercise contains a test file.
+Run the tests using the `bats` program.
+
+```bash
+bats test-hello-world.bats
+```
+
+`bats` will need to be installed.
+See the [Testing on the Bash track][bash] page for instructions to install `bats` for your system.
+
+### bats is implemented in bash
+
+The bats file is a bash script, with some special functions recognized by the `bats` command.
+You'll see some tests that look like
+
+```sh
+jq -f some-exercise.jq <<< "{some,json,here}"
+```
+
+That `<<<` syntax is a bash [Here String][here-string].
+It sends the string on the right-hand side into the standard input of the program on the left-hand side.
+It is ([approximately][so]) the same as
+
+```sh
+echo "{some,json,here}" | jq -f some-exercise.jq
+```
+
+## Help for assert functions
+
+The tests use functions from the [bats-assert][bats-assert] library.
+Help for the various `assert*` functions can be found there.
+
+## Skipped tests
+
+Solving an exercise means making all its tests pass.
+By default, only one test (the first one) is executed when you run the tests.
+This is intentional, as it allows you to focus on just making that one test pass.
+Once it passes, you can enable the next test by commenting out or removing the
+
+    [[ $BATS_RUN_SKIPPED == true ]] || skip
+
+annotations prepending other tests.
+
+## Overriding skips
+
+To run all tests, including the ones with `skip` annotations, you can run:
+
+```bash
+BATS_RUN_SKIPPED=true bats test-some-exercise.bats
+```
+
+It can be convenient to use a wrapper function to save on typing: in `bash` you can do:
+
+```bash
+bats() {
+    BATS_RUN_SKIPPED=true command bats *.bats
+}
+```
+
+Then run tests with just:
+
+```bash
+bats
+```
+
+## Debugging in `jq`
+
+`jq` comes with a handy [`debug`][debug] filter.
+Use it while you are developing your exercise solutions to inspect the data that is currently in the jq pipline.
+See the [debugging doc][debugging] for more details.
+
+
+[bash]: https://exercism.org/docs/tracks/bash/tests
+[bats-assert]: https://github.com/bats-core/bats-assert
+[here-string]: https://www.gnu.org/software/bash/manual/bash.html#Here-Strings
+[so]: https://unix.stackexchange.com/a/80372/4667
+[debug]: https://jqlang.github.io/jq/manual/v1.7/#debug
+[debugging]: https://exercism.org/docs/tracks/jq/debugging
+
+## Submitting your solution
+
+You can submit your solution using the `exercism submit space-age.jq` command.
+This command will upload your solution to the Exercism website and print the solution page's URL.
+
+It's possible to submit an incomplete solution which allows you to:
+
+- See how others have completed the exercise
+- Request help from a mentor
+
+## Need to get help?
+
+If you'd like help solving the exercise, check the following pages:
+
+- The [jq track's documentation](https://exercism.org/docs/tracks/jq)
+- The [jq track's programming category on the forum](https://forum.exercism.org/c/programming/jq)
+- [Exercism's programming category on the forum](https://forum.exercism.org/c/programming/5)
+- The [Frequently Asked Questions](https://exercism.org/docs/using/faqs)
+
+Should those resources not suffice, you could submit your (incomplete) solution to request mentoring.
+
+## Need more help?
+
+- Go to the [Exercism Community forum](https://forum.exercism.org) to get support and ask questions (or just chat!)
+  - Use the [Exercism Support](https://forum.exercism.org/c/support/8) category if you face any issues with working in the web editor, or downloading or submitting your exercises locally.
+  - Use the [Programming:jq](https://forum.exercism.org/c/programming/jq/133) category for jq-specific topics.
+- Join the community on [Exercism's Discord server](https://exercism.org/r/discord).
+- [StackOverflow](https://stackoverflow.com/questions/tagged/jq) can be used to search for your problem and see if it has been answered already.
+  You can also ask and answer questions.
+- [Github issue tracker](https://github.com/exercism/jq/issues) is where we track our development and maintainance of `jq` exercises in exercism.
+  If none of the above links help you, feel free to post an issue here.
\ No newline at end of file
diff --git a/jq/space-age/README.md b/jq/space-age/README.md
new file mode 100644
index 0000000..eb72ab4
--- /dev/null
+++ b/jq/space-age/README.md
@@ -0,0 +1,64 @@
+# Space Age
+
+Welcome to Space Age on Exercism's jq Track.
+If you need help running the tests or submitting your code, check out `HELP.md`.
+
+## Introduction
+
+The year is 2525 and you've just embarked on a journey to visit all planets in the Solar System (Mercury, Venus, Earth, Mars, Jupiter, Saturn, Uranus and Neptune).
+The first stop is Mercury, where customs require you to fill out a form (bureaucracy is apparently _not_ Earth-specific).
+As you hand over the form to the customs officer, they scrutinize it and frown.
+"Do you _really_ expect me to believe you're just 50 years old?
+You must be closer to 200 years old!"
+
+Amused, you wait for the customs officer to start laughing, but they appear to be dead serious.
+You realize that you've entered your age in _Earth years_, but the officer expected it in _Mercury years_!
+As Mercury's orbital period around the sun is significantly shorter than Earth, you're actually a lot older in Mercury years.
+After some quick calculations, you're able to provide your age in Mercury Years.
+The customs officer smiles, satisfied, and waves you through.
+You make a mental note to pre-calculate your planet-specific age _before_ future customs checks, to avoid such mix-ups.
+
+~~~~exercism/note
+If you're wondering why Pluto didn't make the cut, go watch [this YouTube video][pluto-video].
+
+[pluto-video]: https://www.youtube.com/watch?v=Z_2gbGXzFbs
+~~~~
+
+## Instructions
+
+Given an age in seconds, calculate how old someone would be on a planet in our Solar System.
+
+One Earth year equals 365.25 Earth days, or 31,557,600 seconds.
+If you were told someone was 1,000,000,000 seconds old, their age would be 31.69 Earth-years.
+
+For the other planets, you have to account for their orbital period in Earth Years:
+
+| Planet  | Orbital period in Earth Years |
+| ------- | ----------------------------- |
+| Mercury | 0.2408467                     |
+| Venus   | 0.61519726                    |
+| Earth   | 1.0                           |
+| Mars    | 1.8808158                     |
+| Jupiter | 11.862615                     |
+| Saturn  | 29.447498                     |
+| Uranus  | 84.016846                     |
+| Neptune | 164.79132                     |
+
+~~~~exercism/note
+The actual length of one complete orbit of the Earth around the sun is closer to 365.256 days (1 sidereal year).
+The Gregorian calendar has, on average, 365.2425 days.
+While not entirely accurate, 365.25 is the value used in this exercise.
+See [Year on Wikipedia][year] for more ways to measure a year.
+
+[year]: https://en.wikipedia.org/wiki/Year#Summary
+~~~~
+
+## Source
+
+### Created by
+
+- @glennj
+
+### Based on
+
+Partially inspired by Chapter 1 in Chris Pine's online Learn to Program tutorial. - https://pine.fm/LearnToProgram/?Chapter=01
\ No newline at end of file
diff --git a/jq/space-age/bats-extra.bash b/jq/space-age/bats-extra.bash
new file mode 100644
index 0000000..54d4807
--- /dev/null
+++ b/jq/space-age/bats-extra.bash
@@ -0,0 +1,637 @@
+# This is the source code for bats-support and bats-assert, concatenated
+# * https://github.com/bats-core/bats-support
+# * https://github.com/bats-core/bats-assert
+#
+# Comments have been removed to save space. See the git repos for full source code.
+
+############################################################
+#
+# bats-support - Supporting library for Bats test helpers
+#
+# Written in 2016 by Zoltan Tombol <zoltan dot tombol at gmail dot com>
+#
+# To the extent possible under law, the author(s) have dedicated all
+# copyright and related and neighboring rights to this software to the
+# public domain worldwide. This software is distributed without any
+# warranty.
+#
+# You should have received a copy of the CC0 Public Domain Dedication
+# along with this software. If not, see
+# <http://creativecommons.org/publicdomain/zero/1.0/>.
+#
+
+fail() {
+  (( $# == 0 )) && batslib_err || batslib_err "$@"
+  return 1
+}
+
+batslib_is_caller() {
+  local -i is_mode_direct=1
+
+  # Handle options.
+  while (( $# > 0 )); do
+    case "$1" in
+      -i|--indirect) is_mode_direct=0; shift ;;
+      --) shift; break ;;
+      *) break ;;
+    esac
+  done
+
+  # Arguments.
+  local -r func="$1"
+
+  # Check call stack.
+  if (( is_mode_direct )); then
+    [[ $func == "${FUNCNAME[2]}" ]] && return 0
+  else
+    local -i depth
+    for (( depth=2; depth<${#FUNCNAME[@]}; ++depth )); do
+      [[ $func == "${FUNCNAME[$depth]}" ]] && return 0
+    done
+  fi
+
+  return 1
+}
+
+batslib_err() {
+  { if (( $# > 0 )); then
+      echo "$@"
+    else
+      cat -
+    fi
+  } >&2
+}
+
+batslib_count_lines() {
+  local -i n_lines=0
+  local line
+  while IFS='' read -r line || [[ -n $line ]]; do
+    (( ++n_lines ))
+  done < <(printf '%s' "$1")
+  echo "$n_lines"
+}
+
+batslib_is_single_line() {
+  for string in "$@"; do
+    (( $(batslib_count_lines "$string") > 1 )) && return 1
+  done
+  return 0
+}
+
+batslib_get_max_single_line_key_width() {
+  local -i max_len=-1
+  while (( $# != 0 )); do
+    local -i key_len="${#1}"
+    batslib_is_single_line "$2" && (( key_len > max_len )) && max_len="$key_len"
+    shift 2
+  done
+  echo "$max_len"
+}
+
+batslib_print_kv_single() {
+  local -ir col_width="$1"; shift
+  while (( $# != 0 )); do
+    printf '%-*s : %s\n' "$col_width" "$1" "$2"
+    shift 2
+  done
+}
+
+batslib_print_kv_multi() {
+  while (( $# != 0 )); do
+    printf '%s (%d lines):\n' "$1" "$( batslib_count_lines "$2" )"
+    printf '%s\n' "$2"
+    shift 2
+  done
+}
+
+batslib_print_kv_single_or_multi() {
+  local -ir width="$1"; shift
+  local -a pairs=( "$@" )
+
+  local -a values=()
+  local -i i
+  for (( i=1; i < ${#pairs[@]}; i+=2 )); do
+    values+=( "${pairs[$i]}" )
+  done
+
+  if batslib_is_single_line "${values[@]}"; then
+    batslib_print_kv_single "$width" "${pairs[@]}"
+  else
+    local -i i
+    for (( i=1; i < ${#pairs[@]}; i+=2 )); do
+      pairs[$i]="$( batslib_prefix < <(printf '%s' "${pairs[$i]}") )"
+    done
+    batslib_print_kv_multi "${pairs[@]}"
+  fi
+}
+
+batslib_prefix() {
+  local -r prefix="${1:-  }"
+  local line
+  while IFS='' read -r line || [[ -n $line ]]; do
+    printf '%s%s\n' "$prefix" "$line"
+  done
+}
+
+batslib_mark() {
+  local -r symbol="$1"; shift
+  # Sort line numbers.
+  set -- $( sort -nu <<< "$( printf '%d\n' "$@" )" )
+
+  local line
+  local -i idx=0
+  while IFS='' read -r line || [[ -n $line ]]; do
+    if (( ${1:--1} == idx )); then
+      printf '%s\n' "${symbol}${line:${#symbol}}"
+      shift
+    else
+      printf '%s\n' "$line"
+    fi
+    (( ++idx ))
+  done
+}
+
+batslib_decorate() {
+  echo
+  echo "-- $1 --"
+  cat -
+  echo '--'
+  echo
+}
+
+############################################################
+
+assert() {
+  if ! "$@"; then
+    batslib_print_kv_single 10 'expression' "$*" \
+    | batslib_decorate 'assertion failed' \
+    | fail
+  fi
+}
+
+assert_equal() {
+  if [[ $1 != "$2" ]]; then
+    batslib_print_kv_single_or_multi 8 \
+    'expected' "$2" \
+    'actual'   "$1" \
+    | batslib_decorate 'values do not equal' \
+    | fail
+  fi
+}
+
+assert_failure() {
+  : "${output?}"
+  : "${status?}"
+
+  (( $# > 0 )) && local -r expected="$1"
+  if (( status == 0 )); then
+    batslib_print_kv_single_or_multi 6 'output' "$output" \
+    | batslib_decorate 'command succeeded, but it was expected to fail' \
+    | fail
+  elif (( $# > 0 )) && (( status != expected )); then
+    { local -ir width=8
+      batslib_print_kv_single "$width" \
+      'expected' "$expected" \
+      'actual'   "$status"
+      batslib_print_kv_single_or_multi "$width" \
+      'output' "$output"
+    } \
+    | batslib_decorate 'command failed as expected, but status differs' \
+    | fail
+  fi
+}
+
+assert_line() {
+  local -i is_match_line=0
+  local -i is_mode_partial=0
+  local -i is_mode_regexp=0
+  : "${lines?}"
+
+  # Handle options.
+  while (( $# > 0 )); do
+    case "$1" in
+    -n|--index)
+      if (( $# < 2 )) || ! [[ $2 =~ ^([0-9]|[1-9][0-9]+)$ ]]; then
+        echo "\`--index' requires an integer argument: \`$2'" \
+        | batslib_decorate 'ERROR: assert_line' \
+        | fail
+        return $?
+      fi
+      is_match_line=1
+      local -ri idx="$2"
+      shift 2
+      ;;
+    -p|--partial) is_mode_partial=1; shift ;;
+    -e|--regexp) is_mode_regexp=1; shift ;;
+    --) shift; break ;;
+    *) break ;;
+    esac
+  done
+
+  if (( is_mode_partial )) && (( is_mode_regexp )); then
+    echo "\`--partial' and \`--regexp' are mutually exclusive" \
+    | batslib_decorate 'ERROR: assert_line' \
+    | fail
+    return $?
+  fi
+
+  # Arguments.
+  local -r expected="$1"
+
+  if (( is_mode_regexp == 1 )) && [[ '' =~ $expected ]] || (( $? == 2 )); then
+    echo "Invalid extended regular expression: \`$expected'" \
+    | batslib_decorate 'ERROR: assert_line' \
+    | fail
+    return $?
+  fi
+
+  # Matching.
+  if (( is_match_line )); then
+    # Specific line.
+    if (( is_mode_regexp )); then
+      if ! [[ ${lines[$idx]} =~ $expected ]]; then
+        batslib_print_kv_single 6 \
+        'index' "$idx" \
+        'regexp' "$expected" \
+        'line'  "${lines[$idx]}" \
+        | batslib_decorate 'regular expression does not match line' \
+        | fail
+      fi
+    elif (( is_mode_partial )); then
+      if [[ ${lines[$idx]} != *"$expected"* ]]; then
+        batslib_print_kv_single 9 \
+        'index'     "$idx" \
+        'substring' "$expected" \
+        'line'      "${lines[$idx]}" \
+        | batslib_decorate 'line does not contain substring' \
+        | fail
+      fi
+    else
+      if [[ ${lines[$idx]} != "$expected" ]]; then
+        batslib_print_kv_single 8 \
+        'index'    "$idx" \
+        'expected' "$expected" \
+        'actual'   "${lines[$idx]}" \
+        | batslib_decorate 'line differs' \
+        | fail
+      fi
+    fi
+  else
+    # Contained in output.
+    if (( is_mode_regexp )); then
+      local -i idx
+      for (( idx = 0; idx < ${#lines[@]}; ++idx )); do
+        [[ ${lines[$idx]} =~ $expected ]] && return 0
+      done
+      { local -ar single=( 'regexp' "$expected" )
+        local -ar may_be_multi=( 'output' "$output" )
+        local -ir width="$( batslib_get_max_single_line_key_width "${single[@]}" "${may_be_multi[@]}" )"
+        batslib_print_kv_single "$width" "${single[@]}"
+        batslib_print_kv_single_or_multi "$width" "${may_be_multi[@]}"
+      } \
+      | batslib_decorate 'no output line matches regular expression' \
+      | fail
+    elif (( is_mode_partial )); then
+      local -i idx
+      for (( idx = 0; idx < ${#lines[@]}; ++idx )); do
+        [[ ${lines[$idx]} == *"$expected"* ]] && return 0
+      done
+      { local -ar single=( 'substring' "$expected" )
+        local -ar may_be_multi=( 'output' "$output" )
+        local -ir width="$( batslib_get_max_single_line_key_width "${single[@]}" "${may_be_multi[@]}" )"
+        batslib_print_kv_single "$width" "${single[@]}"
+        batslib_print_kv_single_or_multi "$width" "${may_be_multi[@]}"
+      } \
+      | batslib_decorate 'no output line contains substring' \
+      | fail
+    else
+      local -i idx
+      for (( idx = 0; idx < ${#lines[@]}; ++idx )); do
+        [[ ${lines[$idx]} == "$expected" ]] && return 0
+      done
+      { local -ar single=( 'line' "$expected" )
+        local -ar may_be_multi=( 'output' "$output" )
+        local -ir width="$( batslib_get_max_single_line_key_width "${single[@]}" "${may_be_multi[@]}" )"
+        batslib_print_kv_single "$width" "${single[@]}"
+        batslib_print_kv_single_or_multi "$width" "${may_be_multi[@]}"
+      } \
+      | batslib_decorate 'output does not contain line' \
+      | fail
+    fi
+  fi
+}
+
+assert_output() {
+  local -i is_mode_partial=0
+  local -i is_mode_regexp=0
+  local -i is_mode_nonempty=0
+  local -i use_stdin=0
+  : "${output?}"
+
+  # Handle options.
+  if (( $# == 0 )); then
+    is_mode_nonempty=1
+  fi
+
+  while (( $# > 0 )); do
+    case "$1" in
+    -p|--partial) is_mode_partial=1; shift ;;
+    -e|--regexp) is_mode_regexp=1; shift ;;
+    -|--stdin) use_stdin=1; shift ;;
+    --) shift; break ;;
+    *) break ;;
+    esac
+  done
+
+  if (( is_mode_partial )) && (( is_mode_regexp )); then
+    echo "\`--partial' and \`--regexp' are mutually exclusive" \
+    | batslib_decorate 'ERROR: assert_output' \
+    | fail
+    return $?
+  fi
+
+  # Arguments.
+  local expected
+  if (( use_stdin )); then
+    expected="$(cat -)"
+  else
+    expected="${1-}"
+  fi
+
+  # Matching.
+  if (( is_mode_nonempty )); then
+    if [ -z "$output" ]; then
+      echo 'expected non-empty output, but output was empty' \
+      | batslib_decorate 'no output' \
+      | fail
+    fi
+  elif (( is_mode_regexp )); then
+    if [[ '' =~ $expected ]] || (( $? == 2 )); then
+      echo "Invalid extended regular expression: \`$expected'" \
+      | batslib_decorate 'ERROR: assert_output' \
+      | fail
+    elif ! [[ $output =~ $expected ]]; then
+      batslib_print_kv_single_or_multi 6 \
+      'regexp'  "$expected" \
+      'output' "$output" \
+      | batslib_decorate 'regular expression does not match output' \
+      | fail
+    fi
+  elif (( is_mode_partial )); then
+    if [[ $output != *"$expected"* ]]; then
+      batslib_print_kv_single_or_multi 9 \
+      'substring' "$expected" \
+      'output'    "$output" \
+      | batslib_decorate 'output does not contain substring' \
+      | fail
+    fi
+  else
+    if [[ $output != "$expected" ]]; then
+      batslib_print_kv_single_or_multi 8 \
+      'expected' "$expected" \
+      'actual'   "$output" \
+      | batslib_decorate 'output differs' \
+      | fail
+    fi
+  fi
+}
+
+assert_success() {
+  : "${output?}"
+  : "${status?}"
+
+  if (( status != 0 )); then
+    { local -ir width=6
+      batslib_print_kv_single "$width" 'status' "$status"
+      batslib_print_kv_single_or_multi "$width" 'output' "$output"
+    } \
+    | batslib_decorate 'command failed' \
+    | fail
+  fi
+}
+
+refute() {
+  if "$@"; then
+    batslib_print_kv_single 10 'expression' "$*" \
+    | batslib_decorate 'assertion succeeded, but it was expected to fail' \
+    | fail
+  fi
+}
+
+refute_line() {
+  local -i is_match_line=0
+  local -i is_mode_partial=0
+  local -i is_mode_regexp=0
+  : "${lines?}"
+
+  # Handle options.
+  while (( $# > 0 )); do
+    case "$1" in
+    -n|--index)
+      if (( $# < 2 )) || ! [[ $2 =~ ^([0-9]|[1-9][0-9]+)$ ]]; then
+        echo "\`--index' requires an integer argument: \`$2'" \
+        | batslib_decorate 'ERROR: refute_line' \
+        | fail
+        return $?
+      fi
+      is_match_line=1
+      local -ri idx="$2"
+      shift 2
+      ;;
+    -p|--partial) is_mode_partial=1; shift ;;
+    -e|--regexp) is_mode_regexp=1; shift ;;
+    --) shift; break ;;
+    *) break ;;
+    esac
+  done
+
+  if (( is_mode_partial )) && (( is_mode_regexp )); then
+    echo "\`--partial' and \`--regexp' are mutually exclusive" \
+    | batslib_decorate 'ERROR: refute_line' \
+    | fail
+    return $?
+  fi
+
+  # Arguments.
+  local -r unexpected="$1"
+
+  if (( is_mode_regexp == 1 )) && [[ '' =~ $unexpected ]] || (( $? == 2 )); then
+    echo "Invalid extended regular expression: \`$unexpected'" \
+    | batslib_decorate 'ERROR: refute_line' \
+    | fail
+    return $?
+  fi
+
+  # Matching.
+  if (( is_match_line )); then
+    # Specific line.
+    if (( is_mode_regexp )); then
+      if [[ ${lines[$idx]} =~ $unexpected ]]; then
+        batslib_print_kv_single 6 \
+        'index' "$idx" \
+        'regexp' "$unexpected" \
+        'line'  "${lines[$idx]}" \
+        | batslib_decorate 'regular expression should not match line' \
+        | fail
+      fi
+    elif (( is_mode_partial )); then
+      if [[ ${lines[$idx]} == *"$unexpected"* ]]; then
+        batslib_print_kv_single 9 \
+        'index'     "$idx" \
+        'substring' "$unexpected" \
+        'line'      "${lines[$idx]}" \
+        | batslib_decorate 'line should not contain substring' \
+        | fail
+      fi
+    else
+      if [[ ${lines[$idx]} == "$unexpected" ]]; then
+        batslib_print_kv_single 5 \
+        'index' "$idx" \
+        'line'  "${lines[$idx]}" \
+        | batslib_decorate 'line should differ' \
+        | fail
+      fi
+    fi
+  else
+    # Line contained in output.
+    if (( is_mode_regexp )); then
+      local -i idx
+      for (( idx = 0; idx < ${#lines[@]}; ++idx )); do
+        if [[ ${lines[$idx]} =~ $unexpected ]]; then
+          { local -ar single=( 'regexp' "$unexpected" 'index' "$idx" )
+            local -a may_be_multi=( 'output' "$output" )
+            local -ir width="$( batslib_get_max_single_line_key_width "${single[@]}" "${may_be_multi[@]}" )"
+            batslib_print_kv_single "$width" "${single[@]}"
+            if batslib_is_single_line "${may_be_multi[1]}"; then
+              batslib_print_kv_single "$width" "${may_be_multi[@]}"
+            else
+              may_be_multi[1]="$( printf '%s' "${may_be_multi[1]}" | batslib_prefix | batslib_mark '>' "$idx" )"
+              batslib_print_kv_multi "${may_be_multi[@]}"
+            fi
+          } \
+          | batslib_decorate 'no line should match the regular expression' \
+          | fail
+          return $?
+        fi
+      done
+    elif (( is_mode_partial )); then
+      local -i idx
+      for (( idx = 0; idx < ${#lines[@]}; ++idx )); do
+        if [[ ${lines[$idx]} == *"$unexpected"* ]]; then
+          { local -ar single=( 'substring' "$unexpected" 'index' "$idx" )
+            local -a may_be_multi=( 'output' "$output" )
+            local -ir width="$( batslib_get_max_single_line_key_width "${single[@]}" "${may_be_multi[@]}" )"
+            batslib_print_kv_single "$width" "${single[@]}"
+            if batslib_is_single_line "${may_be_multi[1]}"; then
+              batslib_print_kv_single "$width" "${may_be_multi[@]}"
+            else
+              may_be_multi[1]="$( printf '%s' "${may_be_multi[1]}" | batslib_prefix | batslib_mark '>' "$idx" )"
+              batslib_print_kv_multi "${may_be_multi[@]}"
+            fi
+          } \
+          | batslib_decorate 'no line should contain substring' \
+          | fail
+          return $?
+        fi
+      done
+    else
+      local -i idx
+      for (( idx = 0; idx < ${#lines[@]}; ++idx )); do
+        if [[ ${lines[$idx]} == "$unexpected" ]]; then
+          { local -ar single=( 'line' "$unexpected" 'index' "$idx" )
+            local -a may_be_multi=( 'output' "$output" )
+            local -ir width="$( batslib_get_max_single_line_key_width "${single[@]}" "${may_be_multi[@]}" )"
+            batslib_print_kv_single "$width" "${single[@]}"
+            if batslib_is_single_line "${may_be_multi[1]}"; then
+              batslib_print_kv_single "$width" "${may_be_multi[@]}"
+            else
+              may_be_multi[1]="$( printf '%s' "${may_be_multi[1]}" | batslib_prefix | batslib_mark '>' "$idx" )"
+              batslib_print_kv_multi "${may_be_multi[@]}"
+            fi
+          } \
+          | batslib_decorate 'line should not be in output' \
+          | fail
+          return $?
+        fi
+      done
+    fi
+  fi
+}
+
+refute_output() {
+  local -i is_mode_partial=0
+  local -i is_mode_regexp=0
+  local -i is_mode_empty=0
+  local -i use_stdin=0
+  : "${output?}"
+
+  # Handle options.
+  if (( $# == 0 )); then
+    is_mode_empty=1
+  fi
+
+  while (( $# > 0 )); do
+    case "$1" in
+    -p|--partial) is_mode_partial=1; shift ;;
+    -e|--regexp) is_mode_regexp=1; shift ;;
+    -|--stdin) use_stdin=1; shift ;;
+    --) shift; break ;;
+    *) break ;;
+    esac
+  done
+
+  if (( is_mode_partial )) && (( is_mode_regexp )); then
+    echo "\`--partial' and \`--regexp' are mutually exclusive" \
+    | batslib_decorate 'ERROR: refute_output' \
+    | fail
+    return $?
+  fi
+
+  # Arguments.
+  local unexpected
+  if (( use_stdin )); then
+    unexpected="$(cat -)"
+  else
+    unexpected="${1-}"
+  fi
+
+  if (( is_mode_regexp == 1 )) && [[ '' =~ $unexpected ]] || (( $? == 2 )); then
+    echo "Invalid extended regular expression: \`$unexpected'" \
+    | batslib_decorate 'ERROR: refute_output' \
+    | fail
+    return $?
+  fi
+
+  # Matching.
+  if (( is_mode_empty )); then
+    if [ -n "$output" ]; then
+      batslib_print_kv_single_or_multi 6 \
+      'output' "$output" \
+      | batslib_decorate 'output non-empty, but expected no output' \
+      | fail
+    fi
+  elif (( is_mode_regexp )); then
+    if [[ $output =~ $unexpected ]]; then
+      batslib_print_kv_single_or_multi 6 \
+      'regexp'  "$unexpected" \
+      'output' "$output" \
+      | batslib_decorate 'regular expression should not match output' \
+      | fail
+    fi
+  elif (( is_mode_partial )); then
+    if [[ $output == *"$unexpected"* ]]; then
+      batslib_print_kv_single_or_multi 9 \
+      'substring' "$unexpected" \
+      'output'    "$output" \
+      | batslib_decorate 'output should not contain substring' \
+      | fail
+    fi
+  else
+    if [[ $output == "$unexpected" ]]; then
+      batslib_print_kv_single_or_multi 6 \
+      'output' "$output" \
+      | batslib_decorate 'output equals, but it was expected to differ' \
+      | fail
+    fi
+  fi
+}
diff --git a/jq/space-age/bats-jq.bash b/jq/space-age/bats-jq.bash
new file mode 100644
index 0000000..3f55da5
--- /dev/null
+++ b/jq/space-age/bats-jq.bash
@@ -0,0 +1,29 @@
+#!/usr/bin/env bash
+#
+# `bats-core` will consume both stdout and stderr for the `run` command's output.
+# However `jq` prints its DEBUG output on stderr.
+#
+# Lines starting with `["DEBUG:",` will be prefixed with a hash and printed on file descriptor 3.
+# Other lines on stderr will remain on stderr for bats to consume.
+#
+# See `bats-core` docs:
+# - "Printing to the terminal", https://bats-core.readthedocs.io/en/stable/writing-tests.html#printing-to-the-terminal
+# - "File descriptor 3", https://bats-core.readthedocs.io/en/stable/writing-tests.html#file-descriptor-3-read-this-if-bats-hangs
+
+
+jq() {
+    local output stderr rc line
+    stderr=$(mktemp)
+    output=$(command jq "$@" 2> "$stderr")
+    rc=$?
+    while IFS= read -r line || [[ -n $line ]]; do
+        if [[ $line == '["DEBUG:",'* ]]; then
+            echo "# $line" >&3
+        else
+            echo "$line" >&2
+        fi
+    done < "$stderr"
+    rm -f "$stderr"
+    echo "$output"
+    return "$rc"
+}
diff --git a/jq/space-age/space-age.jq b/jq/space-age/space-age.jq
new file mode 100644
index 0000000..956dc4e
--- /dev/null
+++ b/jq/space-age/space-age.jq
@@ -0,0 +1,16 @@
+def two_decimal: ((. * 100) | round) / 100;
+
+def ratios:
+  {
+    Mercury: 0.2408467,
+    Venus:   0.61519726,
+    Earth:   1.0,
+    Mars:    1.8808158,
+    Jupiter: 11.862615,
+    Saturn:  29.447498,
+    Uranus:  84.016846,
+    Neptune: 164.79132
+  }[.] // ("not a planet"|halt_error);
+
+# seconds per day: 86400 (60*60*24)
+.seconds/86400/(.planet|ratios*365.25)|two_decimal
diff --git a/jq/space-age/test-space-age.bats b/jq/space-age/test-space-age.bats
new file mode 100644
index 0000000..66d00d2
--- /dev/null
+++ b/jq/space-age/test-space-age.bats
@@ -0,0 +1,140 @@
+#!/usr/bin/env bats
+# generated on 2022-11-02T20:59:49Z
+load bats-extra
+load bats-jq
+
+@test 'age on Earth' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -r -f space-age.jq << 'END_INPUT'
+        {
+          "planet": "Earth",
+          "seconds": 1000000000
+        }
+END_INPUT
+
+    assert_success
+    expected=31.69
+    assert_equal "$output" "$expected"
+}
+
+@test 'age on Mercury' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -r -f space-age.jq << 'END_INPUT'
+        {
+          "planet": "Mercury",
+          "seconds": 2134835688
+        }
+END_INPUT
+
+    assert_success
+    expected=280.88
+    assert_equal "$output" "$expected"
+}
+
+@test 'age on Venus' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -r -f space-age.jq << 'END_INPUT'
+        {
+          "planet": "Venus",
+          "seconds": 189839836
+        }
+END_INPUT
+
+    assert_success
+    expected=9.78
+    assert_equal "$output" "$expected"
+}
+
+@test 'age on Mars' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -r -f space-age.jq << 'END_INPUT'
+        {
+          "planet": "Mars",
+          "seconds": 2129871239
+        }
+END_INPUT
+
+    assert_success
+    expected=35.88
+    assert_equal "$output" "$expected"
+}
+
+@test 'age on Jupiter' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -r -f space-age.jq << 'END_INPUT'
+        {
+          "planet": "Jupiter",
+          "seconds": 901876382
+        }
+END_INPUT
+
+    assert_success
+    expected=2.41
+    assert_equal "$output" "$expected"
+}
+
+@test 'age on Saturn' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -r -f space-age.jq << 'END_INPUT'
+        {
+          "planet": "Saturn",
+          "seconds": 2000000000
+        }
+END_INPUT
+
+    assert_success
+    expected=2.15
+    assert_equal "$output" "$expected"
+}
+
+@test 'age on Uranus' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -r -f space-age.jq << 'END_INPUT'
+        {
+          "planet": "Uranus",
+          "seconds": 1210123456
+        }
+END_INPUT
+
+    assert_success
+    expected=0.46
+    assert_equal "$output" "$expected"
+}
+
+@test 'age on Neptune' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -r -f space-age.jq << 'END_INPUT'
+        {
+          "planet": "Neptune",
+          "seconds": 1821023456
+        }
+END_INPUT
+
+    assert_success
+    expected=0.35
+    assert_equal "$output" "$expected"
+}
+
+@test 'invalid planet causes error' {
+    #[[ $BATS_RUN_SKIPPED == "true" ]] || skip
+
+    run jq -r -f space-age.jq << 'END_INPUT'
+        {
+          "planet": "Sun",
+          "seconds": 680804807
+        }
+END_INPUT
+
+    assert_failure
+    expected='not a planet'
+    assert_equal "$output" "$expected"
+}
+